**Diagram Explanation:**The diagram illustrates a replication fork, with an arrow indicating the direction of movement. The replication fork is the point where the DNA double helix is unwinding to allow replication to occur. - **Replication Fork:** This is the Y-shaped region where the DNA is split into two separate strands.- **Unwinding:** The DNA molecule is unzipping at the replication fork, splitting into two strands. One strand is the leading strand and the other is the lagging strand.**Questions:**(a) Which template strand (top or bottom) is the lead strand?(b) Which strand (top or bottom) would you expect to find the Okazaki fragments?**Answer Options:**- ○ Bottom; Top- ○ Bottom; Bottom- ○ Top; Top- ○ Top; Bottom

DNA (deoxyribonucleic acid) is a nucleic acid. They are double helical structure that wind around…

In the diagram below, the arrow indicates the direction of movement of a replication fork. Replication fork Unwinding (a) Which template strand (top or bottom) is the lead strand? (b) Which strand (top or bottom) would you expect to find the Okazaki fragments?

In the diagram below, the arrow indicates the direction of movement of a replication fork. Replication fork Unwinding (a) Which template strand (top or bottom) is the lead strand? (b) Which strand (top or bottom) would you expect to find the Okazaki fragments?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.
Give the name of the enzyme that catalyzes each of the following reactions:(a) Makes a DNA strand from a DNA template. (b) Makes a DNA strand from an RNA template. (c) Makes an RNA strand from a DNA template
When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and light, N14 DNA to mark the newly synthesized molecules, one band was found in the middle of the centrifuge column after one round of replication, and two bands were found (middle and top of column) after 2 rounds of replication. Imagine that after 1 round of replication 2 bands were found, one at the bottom and one at the top of the centrifuge column. In that case, what model of DNA replication would have been supported? The dispersive model The conservative model The Franklin model The semi-conservative model
Using the numbered sites on the DNA double helix strands below, where would the DNA Primer ACTTGCGA bind to for DNA Amplification?
Give typing answer with explanation and conclusion
DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…
The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication.Please supply the specific pieces of information requested by the boxes below.
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: a) ...TAGT... ...ATCA... b) ...TACT... ...ATGA... c)...TAAT... ...ATTA... d) ...TAAT... ...AT_A... . e) ...TA_T... ...ATAA... f)...TATT... ...ATAA...
Imagine a bacterial cell with a mutation that renders helicase completely nonfunctional (note that this would be a lethal mutation). What, precisely, would go wrong with replication in this cell? Please describe what goes wrong, as well as all downstream effects.
Depurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: ...TAGT... ...ATCA... 1. ...TACT... ...ATGA... 2. ...TAAT... ...ATTA... 3. ...TAAT... ...AT_A... 4. ...TA_T... ...ATAA... 5. ...TATT... ...ATAA...