With respect to DNA and RNA polymerases which statement is correct? OA) Only DNA polymerases are DNA template driven. OB) Only DNA polymerases require primers. OC) Only RNA polymerases are DNA template driven. OD) Only RNA polymerases require primers. E) Both require a DNA template, activated monomer units and a primer

With respect to DNA and RNA polymerases which statement is correct? OA) Only DNA polymerases are DNA template driven. OB) Only DNA polymerases require primers. OC) Only RNA polymerases are DNA template driven. OD) Only RNA polymerases require primers. E) Both require a DNA template, activated monomer units and a primer

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

High Frequency Recombination results in which of the following? O 1) Plasmid DNA incorporated into the cell 2) Genomic DNA incorporated into the cell 3) Viral DNA incorporated into the cell 4) Plasmid and genomic DNA from the donor cell is incorporated into the recipient cell's genome 5) The movement of genes within the cell through homologous recombination
Which of the following typically causes chromosome mutations such as inversions and translocations? A) Base modifiers B) UV light C) ionizing radiation D) base analogues E) intercalating agents
What is the role of the liquid detergent used in the experiment? a) It allows the DNA to unwind. b) It aids filtration. c) It helps break down the cell membrane. d) It helps keep the DNA soluble in solution.
Which of the following does NOT require a primer? A) PCR-based viral test B) cloning a human gene from mRNA C) subcloning a bacterial gene from one plasmid to another D) DNA fingerprinting for paternity testing E) DNA sequencing
A recombinant plasmid can be used to a.) prevent nondisjunction at meiosis. b.) double the number of chromosomes in a plant cell. c.) cut DNA into restriction fragments. d.) transform a bacterium
The Drug AZT is used to treat AIDS, This drug is a _____ Inhibitor/Activator of _____ a) Competitive; Activator; DNA polymerase b) Noncompetitive; Inhibitor; DNA polymerase c) Competitive; Inhibitor; Reverse Transcriptase d) Noncompetitive; Activator; Reverse Transcriptase
After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’ Which of the following describes the above event? a) an insertion mutation occurred b) a duplication mutation occurred c) a multi-points mutation occurred d) a point-series mutation occurred e) an inversion mutation occurred
You want to propagate large amounts of a DNA fragment. To do this, use a plasmid vector. a) How should this plasmid vector be constructed? b) Also describe the function of the components.
TEIIF Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a a) comes to the complex with the polymerase b b) loosens non-specific interactions with the DNA c) both a and b d) none of the above