A mutation occurs that changes a codon from UCC to UCA. It turns out that thiscodon is for an amino acid in the catalytic site of the enzyme DNA glycosylase, whichis involved in DNA repair. What is the most likely outcome for an organism carryingthis mutation?The mutation will be tolerated by the organism and will lead to no physical changes.Because the organism will no longer be able to perform base excision repair, the organism'sDNA will mutate at a rapid rate. A disease such as cancer will develop rather quickly.Because the organism will no longer be able to perform base excision repair, the organism'sDNA will mutate at a slow but steady rate. Over time, a disease such as cancer will develop.No answer text provided.◄ PreviousNext ▸

Based on the nature of change that occurs in a codon due to a point mutation (mutation at a single…

Answered: A mutation occurs that changes a codon…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

HIV causes AIDS by infecting and destroying the immune system. The virus injects RNA into cells and reverse transcribes RNA into DNA using a viral enzyme called HIV-reverse transcriptase (RT, or Pol). RT functions as a DNA polymerase by making polymers of DNA from the viral RNA template. The standard treatment for HIV infection involves targeting the action of RT (in combination with other inhibitors). However, HIV has a high mutation rate, and can develop 'escape' mutations that reduce inhibitor effectiveness. Two such mutations are the K65R (Lys at position 65 is mutated to Arg) and K70E (Lys at position 70 is mutated to Glu) variants. The structures of deoxythymidine (dT) (normal substrate for DNA polymerase and HIV-reverse transcriptase) and AZT, a drug used in the treatment of HIV, are shown below. AZT works by serving as an alternative substrate for RT. Ideally, it is incorporated to the new DNA strand with comparable efficiency. dT AZT NH HO deoxythymidine…
Mutations can be caused by which process? faulty DNA repair nondisjunction base sequence deletion All of the above
A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive conditions) and expresses the normal phenotype under other conditions (the permissive conditions). One type of conditional mutation is a temperature-sensitive mutation, which expresses the mutant phenotype only at certain temperatures. Strains of E. coli have been isolated that contain temperature-sensitive mutations in genes encoding different components of the replication machinery. In each of these strains, the protein produced by the mutated gene is nonfunctional under the restrictive conditions. You grow these strains under the permissive conditions and then abruptly switch them to the restrictive conditions. After one round of replication under therestrictive conditions, you isolate DNA from each strain and analyze it. What characteristics would you expect to see in the DNA isolated from a strain with a temperature-sensitive mutation in the gene that encodes the following…
The following is an example of what type of mutation? Normal DNA: 5' - ATGACGTCA - 3' Mutated DNA: 5' - ATGAGTCA - 3' Deletion Insertion Frameshift Silent
A conditional mutation expresses its mutant phenotype only under certain conditions (the restrictive conditions) and expresses the normal phenotype under other conditions (the permissive conditions). One type of conditional mutation is a temperature-sensitive mutation, which expresses the mutant phenotype only at certain temperatures. Strains of E. coli have been isolated that contain temperature-sensitive mutations in genes encoding different components of the replication machinery. In each of these strains, the protein produced by the mutated gene is nonfunctional under the restrictive conditions. You grow these strains under the permissive conditions and then abruptly switch them to the restrictive conditions. After one round of replication under therestrictive conditions, you isolate DNA from each strain and analyze it. What characteristics would you expect to see in the DNA isolated from a strain with a temperature-sensitive mutation in the gene that encodes the following…
An enzyme is needed for the Krebs Cycle. It will be made following the directions contained in a gene of one of the __29__ found in the __30__ of the cell. A portion of the double strand of __31__ splits apart between the weak__32__bonds holding the bases together. This portion contains the code for building the enzyme. The code message begins with a triplet call a _33__ , followed by the code, then signals the end with a triplet called the _34__. The DNA is composed of groups of three molecules called __35__ . They are made up of ribose __36__, a __37___ for additional support, and a nitrogenous __38___. These match up with complementary ones on the opposite strand of DNA. A cytosine will pair up with __39___. An RNA uracil will pair up with __40___ on the DNA. When they line up and join, a __41__ RNA strand is formed. This process of copying the code into RNA is called __42__. The RNA will move out to the cytoplasm, to an organelle called a __43__. There, __44___ RNA…
A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: AAG TAT TAT GCA A mutation in the above sequence involved the insertion of a single base, leading to a shift in the reading frame of the gene, resulting in altered amino acids downstream from the insertion. Which of the following gene sequences exemplifies the mutation described above? a. AAG CTA TTA TGC A b. AG TAT TAT GCA c. AAG TATU TAT GCA d. AAG TAT TAGT GCA
Many microbes (as well as other organisms) produce antibiotics. A natural compound produced by one organism that inhibits or kills another unrelated organism is commonly defined as an antibiotic. Thousands of antibiotics have been identified and characterized. Antibiotics prevent virtually every step in the Central Dogma of bacteria. Rifampicin, for example, inhibits transcription while streptomycin inhibits translation. However, no antibiotic has ever been discovered that directly affects DNA replication by inhibiting the action of DNA polymerases. "Why not?"
An enzyme is needed for the Krebs Cycle. It will be made following the directions contained in a gene of one of the __29__ found in the __30__ of the cell. A portion of the double strand of __31__ splits apart between the weak__32__bonds holding the bases together. This portion contains the code for building the enzyme. The code message begins with a triplet call a _33__ , followed by the code, then signals the end with a triplet called the _34__. The DNA is composed of groups of three molecules called __35__ . They are made up of ribose __36__, a __37___ for additional support, and a nitrogenous __38___. These match up with complementary ones on the opposite strand of DNA. A cytosine will pair up with __39___. An RNA uracil will pair up with __40___ on the DNA. When they line up and join, a __41__ RNA strand is formed. This process of copying the code into RNA is called __42__. The RNA will move out to the cytoplasm, to an organelle called a __43__. There, __44___ RNA…
Which type of mutation is most likely to be silent? An inversion A deletion An insertion OA substitution
Which kind of chemical damage is depicted in this picture: 2-OH Ostrand breakage Obase deletion Obase modification O base cross linking is in
This type of mutation, where one nucleotide was replaced for another, is called a point mutation. White skin and blue eyes are examples of point mutations.Provide the mRNA that will be made from the mutated strand : 3' TAATATATCCGTACCGTTTAAAGGGTTACATAATTTTTCATCCCATTA5'

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS