Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one correct answer only) A. Blood shot eyes B. dermatitis C. cheilosis D. Wernicke-korsakoff syndrome
Q: D-Erythrulose in cyclic form:
A: Erythrulose is chemically teterose carbohydrates.formula for erythrulose is C4H8O4. It is used in co...
Q: What chemical structure should be present in an amino acid or protein to give a positive Xanthoprote...
A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas ...
A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to ...
Q: 1. Draw NEW amino acids; name them and characterize them 2. Make two dipeptides with your two new am...
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines...
Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1
A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide bonds...
Q: n the brain and muscles, in order for cytoplasmic NADH to insert its electrons int the electron tran...
A:
Q: Briefly describe four ways in which a protein could be denatured.
A: The highly organized structures of proteins are true works of chemical architecture. Denaturation re...
Q: 12. RNase A is a ribonuclease enzyme that degrades single stranded RNA. There are three key amino ac...
A: RNaseA catalysis is a typical example of acid base catalysis. Histidine is a common amino acid in th...
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial...
A: From the above data, S1 = 0.0.3 mmol/L km is around 0.06 mmol/L Initial velocity V01 = 1.5*10-3 V0...
Q: Propose a reasonable biosynthesis for Compound 14. MUST BE in this order: Acetyl CoA SAM S-alanine S...
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep p...
Q: Enumerate the similarities and the differences of Chlorophyll A and B. Similarities Differences
A: Introduction: Chlorophyll is a natural fat-soluble molecule found in plants that allow plants to con...
Q: What are the general characteristics of the primary, secondary, tertiary, and quaternary structure o...
A: Proteins are unbranched polymers constructed from 22 standard amino acid. They have four levels of t...
Q: An infant with corneal clouding has dermatan sulfate and heparan sulfate in his urine. Decreased act...
A: Introduction: The syndrome is also known as mucopolysaccharide type I (MPS I). It is an autosomal r...
Q: Explain when "formulated media" was chosen to be used as a medium in the fermentation process? Menti...
A: A growth medium, also known as a culture media, is a solid, liquid, or semi-solid that is used to he...
Q: Under what conditions will lactic acid accumulate in skeletal muscle? Select one: A. When NADH is d...
A: A reduction in muscle force generated over time or as a result of pathological conditions is referre...
Q: Using a semi-permeable membrane, dialysis allows the removal of salt ions prior to chromatography. T...
A: Dialysis is a separation process that uses selective and passive diffusion via a semi-permeable memb...
Q: Choose two amino acid and explain the metabolism.
A: Introduction: Amino acids are molecules that contain an amine and carboxylic group with side-chain ...
Q: -Inhibitor +Inhibitor [S] (mM) V0&νβσπ; (μmol/sec). V0&νβσπ:&νβ σπ: (μmollsec) 0.0001 33 17 0.0005 7...
A: Km of an enzyme is the substrate concentration at half Vmax. It can be calculated from lb plot by ta...
Q: How does the summary equation for metabolism relate photosynthesis and cellular respiration? Ph...
A: Carbohydrates are a major forms of energy for both animals and plants. While plants have the ability...
Q: 1. Why is it important in Quantitative Analysis to postpone rounding until the calculation is comple...
A: A quantitative analysis is performed to detect the amount of specific substance in a sample solution...
Q: I. Kwashiorkor, also known as «cdematous malnutrition» because of its association with edema (fluid ...
A: Kwashiorkor or Edematous malnutrition: Kwashiorkor is a protein nutritional disorder associated with...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm. Glyc...
Q: CH,OH Он ÓH ÓH
A: The cyclic forms of carbohydrates can exist in different configuration based on the position of the ...
Q: Propose a reasonable biosynthesis for Compound 14 starting from Acetyl CoA, SAM, S- alanine, S-pheny...
A: Here compound 14 is synthesized from L-Phenylalanine in multistep process. The structure of all the ...
Q: Which of the following contain statements that are both correct? Aspartame triggers the cellul...
A: Aspartame is an artificial sweetener. It first binds and activate a GPCR. The G-alpha bound to GTP ,...
Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would...
A: The process of translation takes place in the cytoplasm which converts mRNA to protein/en...
Q: -Inhibitor +Inhibitor [S] (mM) Vο&νβσπ: (μmol/sec). Vο&νβσπ:&νβσπ: (μmollsec) 0.0001 33 17 0.0005 71...
A: From the given data, I have calculated 1/S and 1/V0 in absence and presence of inhibitor. The plot b...
Q: Explain under what conditions "substrate concentration" is the limiting factor for enzymatic reactio...
A: Enzyme and substrate bind each other form E-S complex which decomposes to give product. Substrate oc...
Q: 4. The sequence of a peptide A formed by 16 amino acids was determined using a combination of method...
A: Proteins are chain of amino acids linked by peptide bond with release of a water molecule. Alpha car...
Q: Arrange signalling cascade events in chronological order. ...
A: Signaling pathways helps to respond the cells according to the external stimuli. The external stimul...
Q: You have a mixture of positive, negative and neutral proteins. In order to obtain a pure positively ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Differentiate sweet molecules in Column A using the criteria in column B.
A: Given: column A has two components which differs at different aspects as given in column B.
Q: Draw the structure (using chair confirmation of pyranose) of the following disaccharides. (a) 4-0-(a...
A: Disaccharides are carbohydrates that, when hydrolyzed with acids or enzymes, provide two monosacchar...
Q: (a) dues in the polypeptide. Place the label or an arrow on the Ca atom of both residues. Label the ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...
A: Pyruvate carboxylase (PC) is a ligase class enzyme which catalyze the irreversible carboxylation of ...
Q: Which of the following factors favors the formation of the Random DNA Coil? a Enthalpy b Bas...
A: Some parts of the protein chain do not form regular secondary structure or have a consistent hydroge...
Q: Km value of an enzyme
A: here they are talking about enzyme kinematics. The value of Km, app grows as the inhibitor concentra...
Q: A. Heteroglycans are polysaccharides with only one type of monosaccharide unit. Heparin is a heterog...
A: Polysaccharides that are comprised of same type of monosacharide units, then it is termed as homopol...
Q: ATP + H20 → ADP + Pi AG = -30.5kJ/mol 3Na* (inside) + 2K* + ATP4 + H2O→ 3Na* (outside) + 2K* (inside...
A: With the Chemiosmotic Theory, scientists can better understand how mitochondria make ATP. The compl...
Q: Uncatalyzed -Enzyme A - Enzyme B C12H22011 + H,0 2C,H,,0. For the reaction shown, it can reasonably ...
A: Enzymes are biocatalysts which increase the rate of biochemical reactions by decreasing the activati...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: least likely affected by changes
A: The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as protein struc...
Q: Which of the following statements is TRUE for nonpolar amino acid residues of polypeptides or protei...
A: They are hydrophilic and found buried within proteins FALSE. Water soluble proteins contain am...
Q: What are the main ingredients in the manufacture of mayonnaise? Explain the role of each component.
A: Mayonnaise is a food ingredient that is an emulsion of oil, egg yolk, acid and either vinegar or lem...
Q: lysozyme was purified through G50 beads. From your lab experience, you can determine that when going...
A: Chromatography is biochemical separation method for organic molecules or solutes of a compound so...
Q: Describe in as much detail as you can, the fluid mosaic model of a cellular membrane.
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: The configuration of the given structure below is: * CH,OH он ÓH O alpha-L O alpha-D O beta -L O bet...
A: The carbohydrates can be represented by two types of configurations: L-isomer and D-isomer. When the...
Q: The lock-and-key theory described the action of ______. Select one: a. enzymes as locks that fit oth...
A: Lock-and-key theory describes the formation of an enzyme substrate complex. The complementarity betw...
Q: A HEPTAPEPTIDE that punctures the bacterial cell wall has just been recently isolated from the venom...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids con...
Q: Which of the following samples are expected to cause a decrease in absorbance over time when perform...
A: Ensuring adequate light reaching a detector by using water colloidal solutions in light or X-ray be...
Step by step
Solved in 2 steps
- Kindly select all the normal age-related physiological changes and in one or two sentences explain your answer. a. Decline in visual acuity b. Decrease respiratory rate c. Increased heart rate d. Increase susceptibility to urinary tract infection (UTI) e. Decline in long-term memory f. Increased incidence of awakening after sleep onset33-year- old man was admitted to the hospital for a colonoscopy. An intravenous injection of diazepam was given before the procedure to induce a conscious sedation. Which of the following symptoms did the patient most likely experience upon recovery from sedation? a. Nausea and vomiting O b. Delusional thoughtsD0000000000 O c. Anterograde amnesia Ở d. Increased respiratory rate e. Limb muscle spasmsMy question is Explain why you feel numbness when using a topically applied pain cream that contains lidocaine.
- Which of the following techniques involves passing a mild current through the brain to activate certain structures without damaging them? a. electroconvulsive tomography (ECT) b. magnetic resonance imaging (MRI) c. deep brain lesioning d. electrical stimulation of the brain (ESB)Define the following terms:a. methotrexateb. circadian rhythmsc. calmodulind. Lesch-Nyhan syndromee. thioredoxin reductaseA medical term for the condition commonly known as a bunion is __________________.
- Please asap. thnku A 16-year old girl recently began exhibiting inappropriate behavior such as disrobing in front of others, licking objects on the ground, eating larger than normal portions at mealtime, and making sexual advances toward her brother. She most likely has a lesion in her amygdala and what syndrome? a.Parinaud’s syndrome b.Klien-Levin syndrome c.Kluver-Bucy syndrome d.Korsakoff’s syndromeIf Devan’s brain is producing serotonin and GABA, he would need to get plenty of which vitamins in order to make them? Group of answer choices Thiamin and pantothenic acid Pyridoxine and pantothenic acid Niacin and thiamin Pyridoxine and thiaminePatricia Savon is 34 years old. She has come to the clinic because of a general feeling of weakness and some difficulty walking. She also has had problems with her vision. When you bring Patricia to the examining room, she asks you to leave the door open because she is afraid of being shut inside. The physician does a physical examination on Patricia and orders some diagnostic tests. A possible diagnosis for Patricia is multiple sclerosis. 1. The fear that Patricia experiences is known as _______________. 2. Understanding Patricia’s fears, what type of nuclear imaging test will be ordered for her? 3. Patricia wants to know how nuclear imaging works; she is afraid of radiation. Explain to her how imaging devices work. 4. What additional instructions and information can you give Patricia regarding the test? 5. Are there other imaging tests that could be ordered for Patricia?
- PLEASE CHOOSE THE LETTER OF THE CORRECT ANSWER. 1.) A mentally healthy person can: A. Adapt to changeB. Make friends casily C. Live with problems D. Accept adversity2.) While on a date you observed that your friend is left handed and try to analyze idea or concept logically, you have learned in our lecture that they are said to use: A. Cerebellum B. Left hemisphere of cerebrum C. Right hemisphere of cerebrum D. Brainstem3.) As an adolescent it is difficult to make decisions, one has to weigh decisions if it is the truth or if what you are doing is based on the moral conscience that you have. This is a good example of what specific component of personality: A. ID B. SUPEREGO C. Defense Mechanisms D. EGO4.) Because of the covid 19 pandemic, psychologists noticed an increased incidence of anxiety around the world. Anxiety has been attributed to excess: A. Dopamine B. Norepinephrine5.) It's a method to preserve or protect the self and cope with basic drives of emotionally painful…Mr. Pitt was diagnosed with presbyopia, which is characterized by a. a reduction in accommodative ability as a result of a loss of lens elasticity b. decreased dopamine signaling C. pronounced visual difficulty in the early teenage years d. decreased firing of bipolar neurons in the retina e. excessive refractive power in the lens system of the eyeBobby has been diagnosed with PKU. His mother wants to know about the treatments. What would you tell her?