What protein is the target for most or all O the RNA-dependent RNA polymerase O the ORF 8 protein Othe spike protein myosin heavy chain

Q: Which of the fokmang the first event to take place in A base pairing of activated methionine-IRNA to…

A: Transcription is the process of making RNA copy of DNA. Translation is the process of making…

Q: Match the primary sequence to its characteristics/function/fate 1. mostly hydrophobic, interacts…

A: Cell signaling is an essential component in the cell biology. The signal transduction is carried out…

Q: O It protects mRNA from enzymes that might break it down O The tail consists of a string of As…

A: The addition of poly A tail to a mature  mRNA is a post transcriptional modification that occurs in…

Q: Which protein of ß galactosidase includes a MCS? Alpha fragment 'lac z gene '2lacz gene 'lacz3gene

A: Lac Z gene is found in the MCS. MCS stands for multiple cloning site. This site is responsible for…

Q: ICH one is the next tRNA that will arrive to the "A" site of this ribosome? 000000 Gly Arg Glu Pro…

A: The A site is where the next tRNA molecule carrying an amino acid binds to the mRNA. The tRNA…

Q: Dystrophin gene structe 3 T Elijah's X G Promoter Exon 19 Exon 52 Intron Exon 53 T Liam's X affected…

A: The gene is the sequence of nucleotide that encode a particular protein.

Q: what molecular complex serves as a recognition. factor for premature stop codons? exon-junction…

A: Codons are the combinations of three nucleotides and specify the amino acids during the process of…

Q: Explain how RNA-binding proteins regulate the translationof specific mRNAs, using the regulation of…

A: The cellular iron content is maintained by the IRP-IRE regulatory mechanism. IRPs are cytosolic…

Q: What is mechanism of intein splicing to join P1 and P2 ? Which steps are reversible and which ones…

A: DNA is the genetic carrier that carries genetic information from one generation to another. DNA is…

Q: In group II introns, the splicing reaction is initiated by an internal O purine pyrimidine O both…

A: Purine : Adenine and Guanine Pyrimidine: Thymine and cytosine

Q: Woite Short notes oo tRN A.

A: RNA is ribonucleicacid which is made up of sugar phosphate and nitrogenous base.

Q: Many amino acids have multiple condons The signal there creation. For example both a G and AAA code…

A: Genetic Codon are the sequence of nucleotide which codes for a specific amino acid during synthesis…

Q: Predict the sequence of amino acids coded by the mRNA sequence 5’ GGA–GGC–ACA–UGG–GAA 3’

A: The single strand of the RNA molecule, which consists of a gene sequence and carries the message…

Q: What about the ribosome is NOT true? They are large tRNA-protein complexes. O It is composed of a…

A: Ans- They are large tRNA- protein complexes.

Q: Sequence of amino acids in protein

A: Protein Synthesis: It is the process of creating protein molecules. There are 5 major steps involved…

Q: What type of cytopathic effect is seen when rabies virus infects a monolayer of cells? O the…

A: The cytopathic effect of the rabies virus on a monolayer of cells is characterized by the formation…

Q: Mutations in the nuclear laminproteins cause a large number ofdiseases called laminopathies. What…

A: Lamins are a type of protein that make up the nuclear lamina, which is a layer of proteins just…

Q: The image below shows four membrane proteins. A вс D Select all amphipathic proteins. A В C

A: There are several proteins are associated with the plasma membrane. These proteins are considered as…

Q: Explain what MRNA is and FRNA is.

A: RNA, also known as ribonucleic acid, is a nucleotide polymer composed of a ribose sugar, phosphate,…

Q: When he sell requires a production of the specific proteins what steps must occur

A: Answer: PROTEIN SYNTHESIS = These are the long chains of amino acids together formed in a long…

Q: What is the function of the 3'UTR in the RNA ? Check all that apply V The 3' UTR increases mRNA…

A: Three prime untranslated region(3'-UTR) Section of mRNA that immediately follows the translation…

Q: 1 Foundations Cell Molec The first 17 amino acyl residues in human preproinsulin are…

A: Colinearity simply refers to the relationship between the length of a DNA sequence in a gene and the…

Q: Where does the transcription occur? Where does transition occur?

A: The answer given is in correspondence with translation instead for transition. We assume that to be…

Q: Identify a protein that can contain a temperature-sensitive mutation that would explain these…

A: The mutation is the change in the nucleotide sequence that can be due to some chemical mutagens or…

Q: TOIC Stimulus EUkaryotic cell mi RNA Protein SUp nucleus Deg target mRNA:

A: The diagram illustrates an eukaryotic cell in which micro RNA binds to the target mRNA which has…

Q: Go ahead and repeat the translation process but for Transcription translation Sequence II. Once you…

A: The process of producing proteins from an mRNA template is referred to as translation. Ribosomes…

Q: Which site bound by a tRNA most of the time? O A P O E

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: Look at the figure and predict what would happen if the SRPRNA was unable to stimulate the GTPase…

A: A specific ribonucleoprotein serves the function of recognition and targeting of the protein to the…

Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’    Label the sense and antisense strands…

A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…

Q: Why is GTP necessary for this process?

A: The eukaryotic SRP receptor (termed SR) is a heterodimer of SR-alpha (70 kDa) and SR-beta (25 kDa),…

Q: Eukaryotes have very different mRNA processing than prokaryotes do. Please check all that are…

A: Gene expression involves two processes that is- transcription and translation. Transcription is a…

Q: Proteins play many different and important roles in the body. Explain how all of the types of…

A: Proteins Proteins are made up of long chain of amino acids. To make a protein, twenty different…

Q: GAC TATGCGGGA GGT GAAGCC ATGA would happen If fourrt A in the given sbrand mutated to t 2 And in…

A: Mutations are changes in the DNA sequence that occurs as a result of errors in the DNA copying…

Q: Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yes or no 20…

A: The eukaryotic organisms have well defined nucleus in the cell. The messenger RNA is synthesized by…

Q: Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG

A: The nucleotides are the building blocks of nucleic acids. The nucleotides are formed of a…

Q: Whcih mRNA molecule will produce more protein in translation>

A: Ans- d) mRNA with a better fit to ribosomal RNA of small subunit  The translation process only…

Q: Transfer RNA molecules are involved in transcription translation O replication reverse transcription

A: t-RNA or transfer RNA molecules have a specific clover leaf-like structure. Generally, RNA molecules…

Q: what is the purpose of the nucleous ?

A: Eukaryotes cells have a nucleus enclosed within a nuclear envelope. There are various cell…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.