What is the function of each of the RNAs below in translation? 1. mRNA 2. tRNA 3. rRNA mRNA tRNA rRNA [Choose ] [Choose ] Attaches to amino acids and takes them to the ribosome Matches up tRNA and mRNA, then bonds amino acids together Copies gene from DNA and takes it to the ribosome [Choose ]

Q: Describe the process by which the information in eukaryotic gene is transcribed and translated into…

A: Eukaryotic gene expression is a complex process that involves transcription as well as translation.…

Q: What occurs during transcription? Where in the cell does this take place?

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: During translation, the growing peptide chain resides in the P site of FRNA with the next amino acid…

A: Answer: CENTRAL DOGMA = This is the basic mechanism by which DNA is replicate and transcript in the…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: What does the A site on the ribosome do?     What does the P site on the ribosome do?…

A: The ribosome is a complex molecule made up of ribosomal RNA molecules and proteins that functions as…

Q: After transcription, how is mRNA processed in eukaryotes?  (Choose all that apply) 3' polyA tail is…

A: TRANSCRIPTION It is the formation of mRNA from DNA. The mRNA formed has to undergo various…

Q: codons are part of the molecular structure of

A:

Q: Human Fbh1 helicase is important in the process of DNA replication. When a muta occurs during the…

A: Introduction : 1) DNA replication is the process by which the genetic material is copied within the…

Q: The "factory" itself, made of two [Choose] subunits [Choose] FRNA The site from which the growing…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…

A: ANSWER;- N'-- C; 5'--3';

Q: Which of the following statements concerning translation is NOT correct? O a. The first codon of…

A: Translation is the process of translating codons on mRNA into proteins. mRNA bind to ribosomes which…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: As the ribosome moves along the mRNA, it is moving from [Select ] The protein grows at the [Select ]…

A: Translation is the process by which the genetic code in mRNA is read to produce a protein. This…

Q: In bacteria, what is the role of the Shine-Dalgarno sequence?   Question 3 options:   It binds to…

A: The Shine-Dalgarno sequenceRibosomal binding site in mRNA.It enables initiation of protein synthesis…

Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Choose the answer that has these events of protein synthesis in the proper sequence. (Note some…

A: The steps of Protein synthesis are collectively  called translation it involves forming proteins…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: Which of the following is NOT true of transfer RNA (tRNA)? Each individual molecule of tRNA can…

A: Introduction  tRNA (Transfer RNA) is a type of RNA molecule that plays a crucial role in the process…

Q: Which nucleic acid has a double helix structure?     tRNA     mRNA     rRNA     DNA

A: Nucleic acids that are present in the environment can be of two different types based on the type of…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: which of the following causes transcription to end? RNA polymerase reaches the terminator RNA…

A: Many processes occur within the cell for its normal functioning. They include replication,…

Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…

A: In molecular biology, the central dogma controls the process of transcription in which DNA is…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: During protein synthesis, which step does NOT require energy? dissociation of the 70S ribosome after…

A: The process of gene expression involves two steps: transcription and translation. Translation is the…

Q: 1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? RNA…

A: Translation is the process by which proteins are synthesized using ribosomes. It takes place in the…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: A codon is: three amino acids on a polypetide that are snipped off by the helicase enzy O sets of…

A: There are total of 64 codons coding for Amino acids.

Q: diagram shows a pre essing. present that splicing bind here. What components of this transcript will…

A: Introduction Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in…

Q: 5' 2. Explain what indicates the beginning of translation, and what tRNA's role is in translation.…

A: TRANSLATION: The method used by a cell to produce proteins utilizing genetic information conveyed by…

Q: As the Ribosome keeps creating peptide bonds, empty tRNAs are ejected from the "E" site. Can you…

A: Chromosome is a thread-like, long structure that contains numerous genes on it. It is present safely…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Q: Which characteristic of mRNA is INCORRECT? Bacterial mRNAs vary in size but usually have about 1000…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: in lecture we learned that translation is the process of what happens when a strand of RNA is…

A: Translation  The process of translating the sequences of mRNA into the amino acid residues to form a…

Q: Break down the mRNA strand into tRNA anticodons. Which series is correct? 6 ACCUAC CHIA CHIC AUC

A: Translating mRNA to tRNA: Decoding the Genetic MessageThe central dogma of molecular biology…