WHAT IF? In Figure 18.17b, the lower cell is synthesizingsignaling molecules, whereas the upper cell is expressingreceptors for these molecules. In terms of gene regulationand cytoplasmic determinants, explain how these cellscame to synthesize different molecules.

Q: Can you explaint it?

A: Gene expression in eukaryotic cells could be a complex process that involves multiple steps, from…

Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'

A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…

Q: List one example of AMPLIFICATION OF SIGNAL during the cell’s response to Hedgehog

A: * Hedgehog signalling pathway is important during embryogenesis to  controll proliferation of tissue…

Q: In unit 1 we learned about the CFTR gene that codes for a chloride channel that does not function…

A: Cystic Fibrosis (CF) is a genetic disorder that is caused by mutations in the CFTR gene. This gene…

Q: Describe the ways in which gene expression is regulated Must include: • Transcription factors •…

A: Transcription factors and Histone acetylation favors gene expression and DNA methylation represses…

Q: Yes or no? is siRNA result of activity of argonaut? Does RNAi result permanently heritable in…

A: Yes, Argonaute proteins are the active part of RNA-induced silencing complex, cleaving the target…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: How does finP inhibit TraJ from activating expression of the tra genes? O It basepairs with the traJ…

A: Here both FinO and FinP play important role  TraJ, is controlled by the action of the antisense RNA,…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: A mutation is a change in the sequence of the DNA that may affect the codons of the DNA or mRNA.…

Q: Amude cel and a skm cel both cartan the same 45 chromosomes, but express d fferent genes. In terms…

A: Muscle cells and skin cells are examples of differentiated cells. The functions of both cells are…

Q: .Is attenuation likely to be involved in eukaryotic gene regulation? Briefly explain your answer.

A: Attenuation is a regulatory mechanism used in bacterial operons to ensure proper transcription and…

Q: Because of the naturally-existing regulation mechanisms of the cell, injecting double- stranded RNA…

A: Introduction : The RNA or ribonucleic acid is a single stranded molecule present in the cell. The…

Q: In the figure below, what is represented by the line labeled A? TFIIB recognition element DNA in m…

A: Transcription of genes includes the formation of RNA using the template DNA. It includes the enzyme…

Q: What would happen if the intracellular domain of a cellsurface receptor was switched with the domain…

A: Chemical signals are released by signalling cells in the form of small, usually volatile or soluble…

Q: Q28. Which of the following is a sequence that would be likely to be bound by a transcription…

A: Transcription factor: To initiate transcription, eukaryotic RNA polymerase requires the help of…

Q: . Cells containing missense mutations in the crp gene(encoding the positive regulator CRP) are Lac−,…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: hypothesis: How will the temperature affect the expression of CHL when ribosome stalling is done in…

A: Introduction :-  CHL is an antibiotic used in various disease or fever  . It is *chloramphenicol*…

Q: In the presence of excess tryptophan, a repressor protein binds the operator of the trp operon and…

A: positive gene regulation in the presence of lactose and low glucose , the lac operon is expressed 20…

Q: Based on my your observations, describe the role of the transcription factors and the regulatory…

A: Central dogma involves a method where RNA formed from DNA , and DNA shows heterocatalytic neture,…

Q: on ni aliuzen en B. Gene A contains a base substitution that results in a nonsense mutation. HTW…

A: A non sense mutation is the one where a codon is converted to stop codon and there is premature…

Q: The association of DNA with nucleosomes means that the default state for eukaryotic genes is to be…

A: By promoting or impeding the attachment of transcription factors along with additional regulatory…

Q: . Using a cDNA library, you isolated two differentcDNA clones that have sequences indicating that…

A: A complementary DNA library (cDNA) represents the genes collection that is encoded into the protein…

Q: A KDEL sequence is necessary for ... Select an answer and submit. For keyboard navigation, use the…

A: According to certain theories, the KDEL receptor controls COPI transport. The development of COPI…

Q: Review how the signal-recognition particle (SRP) and SRP receptor guide proteins containing an ER…

A: The signal recognition particle (SRP) is an abundant, cytosolic, uniformly preserved…

Q: Regulation mechanisms Gene Allosteri- Metabolic Regulatory transcription electronic Phospholation /…

A: Gluconeogenesis is the synthesis of glucose from non-carbohydrate precursors. This is a universal…

Q: Pls help ASAP

A: Gene expression is a procedure through which a gene's information is utilised in the creation of a…

Q: Predict the effect on the target protein if a cyclin undergoes a mutation and is not broken down. O…

A: Mutation is an abrupt change in the DNA sequence which may change the amino acid sequence in a…

Q: How apoptotic pathway can be exploited to treat various cancers?

A: Apoptosis is a series of processes occurring one after the other which results in the death of a…

Q: Alternative splicing is a common mechanism for eukaryotes toexpand their repertoire of gene…

A: Eukaryotic genes are composed of exons and introns.

Q: Hac1 is another chaperone protein that is up-regulated in response to unfolded proteins in the ER.…

A: Introduction  Proteins are essential biomolecules that play a wide range of roles in controlling…

Q: . An interesting mutation in lacI results in repressorswith 110-fold increased binding to both…

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype

A: The sequence of mRNA is CCCUCACAUAUGCCCUACUUCCGCUAA. CCC- PROLINE UCA - SERINE CAU - HISTIDINE AUG-…

Q: The TBX20 transcription factor is important for the developmentof heart tissue. Deletion of the…

A: T-box transcription factor Tbx20 gene in mice is essential for prenatal cardiomyocyte proliferation…