In principle, a eukaryotic cell can regulate gene expression at any step in the pathway from DNA to the active protein. Place the types of control listed below at the appropriate places on the diagram in the figure below. DNA RNA transcript NUCLEUS mRNA A. translation control B. transcriptional control C. RNA processing control D. protein activity control CYTOSOL mRNA nuclear pore nuclear envelope protein inactive protein

Q: Is your mutation a

A: A Mutagen is an agent of substance that can bring about a permanent alteration to the physical…

Q: Q23 Name the region 7889 Q24 Name the structure Q25 Name the

A: Introduction  The kidney, ureters, and urethra make up the renal system. The system as a whole…

Q: What is labeled on the image

A: The human body has five organs essential for survival. These are heart, brain, kidneys, liver, and…

Q: 14-16. List the group (nonpolar, polar, acidic, or basic) for each of the following armino acids:…

A: Amino acids are broadly grouped into polar and nonpolar. Nonpolar amino acids can be further divided…

Q: plzz explained prop

A: Bones are the metabolically active connective tissue that provides the structure support,…

Q: What do you mean by surrogacy?

A: When a woman has some issues with the reproductive system then she opts for surrogacy. When the…

Q: What do you mean by Nissl's granules?

A: Nissl's granules are part of neurons. They perform very important functions and hence is vital for…

Q: The word pus is a noun. It is the result of an infection. The adjective form of pus is

A: Pus is a whitish-yellow, protein-rich fluid also called the liquor puris that generally accumulates…

Q: I go to the doctor with a head cold caused by adenovirus. My doctor gives me a prescription for…

A: Most often, respiratory illnesses are brought on by adenoviruses. The ailments might include…

Q: What do you mean by HIV?

A: Sexually Transmitted Diseases:- These are the diseases which are transferred from an infected person…

Q: Bypassing a checkpoint in the cell cycle may result in a cancer cell Multiple Choice O condensing…

A: The basic process of metastatic conversion is that the cell undergo gain of function mutation in…

Q: Is it ethical to allow patients to suffer if they wish to end their life

A: Fatal diseases that do not have a proper cure and lead to the death of patients are known as…

Q: What’s the term -itis?

A: In anatomy, the medical term consists of more than one word part and each of it has a meaning. The…

Q: What’s a diseases

A: The study of diseases is called pathology. Epidemiology is the study of disease control and…

Q: How did you get that?

A: The probability is zero.

Q: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT -TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG-T…

A: DNA Transcription >mRNA Translation >Amino acid

Q: Record which pole the dyes traveled to by using a (+) for positive and (-) for negative pole. Hint:…

A: Dyes are used during gel electrophoresis to study the movement of DNA or other nucleic acids. They…

Q: Bobby has been diagnosed with PKU. His mother wants to know about the treatments. What would you…

A: Phenylketonuria It is an inherited metabolic disorder, characterized by body's inability to utilize…

Q: What do you mean by Haemophilia?

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: What is the DIFFERENCE between serum and plasma? O a Serum is produced from animal blood but plasma…

A: Difference between serum and plasma

Q: Why are you against Euthanasia for overly aged and severely ill elderly?

A: Introduction: Euthanasia is the act of intentionally  ending a person's life in order to relieve his…

Q: What do you mean by goblet cells?

A: Cell is the basic membrane-bound unit and it is the basic building blocks of all living things.…

Q: In the context of the phosphorous cycle, the arrows and indicate fossilization. Fill in the gaps in…

A: Few important terms which should kept in mind. These are as follows: As we know that the earth is…

Q: What is the best option?

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Apologize and forgive description?

A: Human feelings towards others are of various kinds. Sometimes and with some people these feelings…

Q: What are they?

A: Kingdoms in biological world is one step below the Domain of life which comprises of the broader…

Q: Why do you think some parents are hesitant to get their children vaccinated?

A: Vaccination is the process of introducing a weakened or killed part or whole microorganism that…

Q: Does the HIV virus kill a patient directly?

A: The human immunodeficiency virus (HIV) is a family of retroviruses which are single stranded virus…

Q: قارن بين فحص spt و cpt

A: The Blood Allergy Test (CPT) and the Skin Prick Test (SPT) are two popular tests used to diagnose…

Q: Hesel Bolgal La

A: This diagram is a diagram of spinal cord. The large white portion in the middle part is vertebral…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.