Using Remdesivir against Covid-19 Kokic, Goran, et al. (2021) have shown the mechanism of Remdesivir to fight Covid-19 (see figure below). Why and how (or why not and explain) can Remdesivir be used against Covid- 19? Clue: Recall Sanger dideoxy sequencing and dideoxyNTP. Does Remdesivir remind you of it?

Q: Molecular biology, please explain in detail

A: During the entire migration process, cells could be observed. It was possible to determine the…

Q: If the 5’ splice site sequences changed from 5’GUAAGU 3’ to 5’ GUAUGU 3’, predict the effect of the…

A: RNA produced during transcriptional process containing introns are known as heterogeneous nuclear…

Q: How can the binding assay approach be utilized to match coding triplets with their amino acid…

A: Live cells use the genetic code to turn information encoded in genetic material (DNA or mRNA codon…

Q: Product(wrong) Substrate(wrong) Ku+ nil Ꮩw . IVW Pre-translocation ky+ ky+ KIV+ / niv Err* k₁. ky-nG…

A: High fidelity gene transcription and replication require kinetic discrimination of nucleotide…

Q: Genetics of the Microorganism (RABIES VIRUS) What is the overall mutation rate or general rate of…

A: *Rabies is a fatal encephalomyelitis by the virus belongs to family Rhabdoviridae and  genus…

Q: Apeptide was sequenced and the sequence of fragment sets generated by different cleavage methods is…

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: 2. Design a primer pair using NCBI Primer-BLAST for gene RNA 2',3'-cyclic phosphate and 5'- OH…

A: Forward primer:A primer that binds to antisense or plus strand of DNA is called as forward…

Q: You are interested in amplifying the putative gene encoding the 480-bp protein TMR (Total Memory…

A: We are given with the gene that is needed to be amplified by PCR. The image shows a region of DNA…

Q: what is the biochemical basis for affinity purification of a recombinant protein using a 6X his tag…

A: The DNA sequence specifying a string of six to nine histidine residues is frequently used in vectors…

Q: Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology are…

A: Introduction Molecular biology:- It is the branch of biology that studies the molecular basis of…

Q: Yes or no?   does rNTP's need to synthesize dsRMA? does rna seq allow to detect of splice…

A: rNTP is ribonucleoside triphosphate which is composed of a ribose sugar, 3 phosphate groups attached…

Q: How did the following in-vitro transcription assay utilizing the rrnB promoter help elucidate the UP…

A: In this study, gel electrophoresis was likely utilized to examine the transcription products created…

Q: What is the advantage of homology-directed repair (HDR) ?

A: One of the most vital cellular processes called homology-directed repair (HDR) is capable for fixing…

Q: What primers set should we use for Sequencing on Hemaglutinin and Neuraminidase of H5N1?

A: Influenza is a viral infection that affects mainly the respiratory systems. Influenza A virus…

Q: Find some unclear points in the "initial transcription by RNA polymerase proceeds through a DNA-…

A: Introduction :- Gene expression involves the different set of molecular processes :- replication ,…

Q: - How did the following in-vitro transcription assay utilizing the rrnB promoter help elucidate the…

A: Through a direct contact with the C-terminal domain of the RNA polymerase subunit (CTD), the UP…

Q: Which set of fragment ions is likely from the same population of precursors ions (parent peptide)…

A: ANS:- None of the described choices are likely.

Q: a. How many enhancers were you able to identify with these set of experiments? Explain. b. If you…

A: Enhancers are the term used for the regions of DNA (deoxyribonucleic acid) that elevate the…

Q: Describe the primary procedure(key steps no details) that you will follow to clone the C-peptide…

A: C-peptide or connecting peptide refers to the polypeptide spanning 31 amino acids that connects…

Q: Consider a bacterial promoter with -35 and -10 elements. What assay is best to show that RNA…

A: The electrophoretic mobility shift assay (EMSA) is a method for the detection of protein-nucleic…

Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (?????) in newly synthesized…

A: transcription is the process by which the dna molecules are converted into messenger rna molecule .

Q: Parts A-C in the table show the genotypes for two partial diploid strains of the lac operon. Gene…

A: A group of genes called the lac operon are involved in the bacterial metabolism of lactose. *Three…

Q: Expressing genes encoding a particular protein’s subunits from a plasmid in E. coli cells (volume of…

A: Escherichia coli (E. coli) are group of bacteria that are prevalent in the environment, foods, and…

Q: Explain, the mechanism of chaperone mediated autophagy.

A: Molecular chaperones are proteins that help with conformational folding and unfolding, as well as…

Q: If the binding activity was purified, suggest two experimental approaches that could be taken to…

A: There are numerous experimental techniques that can be used to confirm a purified protein's role as…

Q: both noncoding and coding). a. Which types of SNPs affect protein production or function for the…

A: Single Nucleotide Polymorphisms are the specific differences in the chain of DNA in different…

Q: In biochemical and structural terms, how does the cellular form of the prion protein differ from the…

A: There are different macromolecules present in the living organism. Of which proteins are one of the…

Q: Is the organism causing COVID-19 living or non-living? why? Describe the molecular and cellular…

A: The viruses, bacteria and parasites are responsible for causing different diseases which in human…

Q: Question is attached

A: The lac operon is an Operon or a collection of genes with a single promoter. The genes in the operon…

Q: 1a) In MALDI-TOF data, when performing peptide mass mapping search,  the peptide masses and the…

A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…

Q: What is Stem cell therapy for Covid-19? and What could be its possibilities and challenges?

A: Severe Acute Respiratory Syndrome coronavirus(SARD-CoV)-19 is the virus responsible for novel corona…

Q: Discuss the advantages and disadvantages of targeted vs mass control using COVID-19. ( if you can…

A: Covid-19 is a viral infection caused by a coronavirus.

Q: What sorts of things can we do to help prevent ourselves from catching COVID-19? Explain why these…

A: Coronavirus belongs to the family of Coronaviridae that causes upper respiratory infection. In 2019…

Q: You plate colonies of E. coli with the lac operon an unknown genotype on 1) a medium containing only…

A: The operon is the prokaryotic gene regulatory mechanism that is responsible for the regulation of…

Q: 1) In MALDI-TOF data, when performing peptide mass mapping search, a) The number of peptides…

A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…

Q: Explain how COVID-19 can be detect using molecular based

A: Given: Need to find how the COVID-19- can be detected using molecular based technology. Coronavirus…

Q: What population is at a greater risk for contracting COVID-19 and why?

A: In the United States and around the world, the COVID-19 pandemic has amplified the transdisciplinary…

Q: What is the difference between crRNA and tracrRNA? Why are both needed for Cas9 to function?

A: A prokaryotic adaptive immunity system called CRISPR (Clustered Regularly Interspaced Short…

Q: How do we explain the large expected difference in free energy of binding for high fidelity of DNA…

A: The accuracy of DNA replication is most critical to living organisms. The fidelity of replication is…

Q: Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I…

A: To identify the open reading frame (ORF) in a given DNA sequence, we need to locate the start codon…

Q: Why is zinc being used as prophylaxis for COVID-19?

A: The coronavirus disease is the largest pandemic infectious disease which affected the largest…

Q: Why is there caution against prescribing imatinib with strong CYP3A4 inhibitors?

A: Imatinib is a oral chemotherapy medication which is used for the treatment of cancer.It prevents or…

Q: Pls help ASAP

A: X-Gal stands for 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, and it is indeed a compound…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.