The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the two 18'mer oligonucleotides that you would need as primers for amplifying the underlined region? (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence). 5'-AATCCGACCTGATTCTAAAGCGCGCTAAGAGCTACGTAGGCACCCAT GTTGGAAATCTCTTATCGGAGATTTCTTCTTGATTACTGGCCCTATGCATI GTCATTCCATGCCATCGGTATTCTCGATACTTGTACTTGATGCATTCGA-3' Primer 1: 5'- Primer 2: 5'

The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the two 18'mer oligonucleotides that you would need as primers for amplifying the underlined region? (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence). 5'-AATCCGACCTGATTCTAAAGCGCGCTAAGAGCTACGTAGGCACCCAT GTTGGAAATCTCTTATCGGAGATTTCTTCTTGATTACTGGCCCTATGCATI GTCATTCCATGCCATCGGTATTCTCGATACTTGTACTTGATGCATTCGA-3' Primer 1: 5'- Primer 2: 5'

Name: Question 2: - selecting PCR primersThe sequence shown below is the 5'
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Question 2: - selecting PCR primersThe sequence shown below is the 5' to 3' strand of a dsDNA template. Whatare the sequences of the two 18'mer oligonucleotides that you would need asprimers for amplifying the underlined region? (Select the binding

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 10P: Homologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli...

See similar textbooks

Similar questions

In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
Please help me with this question at the earliest with proper explaination please????
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
Among all these primer pairs from Primer-Blast, which is the best to use for a PCR reaction and why?
6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTG АTGTGGTGGСТАТTGATTAТАААСАСТАСАСАСССТСТТTTAAGAAAGGAGCTAAATTGTTACATAAACС-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5'-CAA TAT TCT TTG GẠC GAA-3' TER O 5-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 5'-CAA TTT AGC TCC TTT CTT-3' Assessment Navigator Submit Questionmark Ondemand licensed to University of Dundee 41 MAR étv 30 MacBook Air DII 20 000 F9 esc F7 F8 F5 F6 F1 F2 F3 F4 2$ & ! 7 8. < co 土

6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design PCR primers to amplify the sequence that is in bold and underlined. (Select the binding sites of your chosen primers within the underlined region rather than in the flanking sequence.) 5'-CAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGG TG ATGTGGTGGCTATTGATTATAAACACTACÃCACCCTCTTTTAAGAAAGGAGC TAAATTGTTACATAAACC-3' What is the 5' to 3' sequence of the reverse primer? O 5-TTC GTC CAA AGA ATA TTC-3' O 5-CAA TAT TCT TTG GAC GAA-3' 5'-GTT AAA TCG AGG AAA GAA-3' O 5-GTT ATA AGA AAC CTG CTT-3 O 5'-CAA TTT AGC TCC TTT CTT-3'
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
What, if any, are potential restriction enzyme recognition sequences in this DNA? (Only consider sequences of 6 bp or longer.) Using any of the sites which you identified in above, illustrate cleavage positions for that site which will result in a 5’ overhang or a 3’ overhang respectively.
You want to amplify the DNA between the twostretches of sequence shown in Figure Q8–3. Of the listedprimers, choose the pair that will allow you to amplify theDNA by PCR.
Primer1: seq1 atatatatccccccatcactgggggg Primer 2: seq2 tatatactagggtacgtatgcccccc
Anspart a, b and c with clear wordings
Please help me with this question urgently????????