The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage) is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline. The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giving the patterns shown below.   What does each pattern say about the cloned DNA

Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…

A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…

Q: Restriction endonuclease digestion of a DNA sequence yielded fragments of the following sizes: 1.…

A: The objective of the question is to determine the order of DNA fragments after gel electrophoresis…

Q: You are trying to clone a gene, You have successfully isolated it from the genomic DNA of an…

A: The term DNA cloning is associated with a process that plays an important role in making copies of a…

Q: A virus with a circular double-stranded DNA chromosome contains approximately 10,000 bp. You want to…

A: To construct a map of the viral chromosome based on the cleavage sites of the restriction…

Q: Sickle cell anaemia is caused by a mutation in the HBB gene. The normal wild-type βA allele contains…

A: Sickle cell anemia is a result of a mutation in the HBB gene. This gene contains the restriction…

Q: The question is:

A: Approach to solving the question: I hope this helps!! Detailed explanation: Examples: Key…

Q: A PCR reaction was performed to amplify the CHE2 gene. The PCR primers used were designed to amplify…

A: Polymerase chain reaction is a molecular biology technique that is sued to synthesize multiple…

Q: This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction…

A: Restrictions endonucleases are enzymes that cut down the DNA into fragments near or at the site of…

Q: Lane 5 in the gel above displays the pBashi cleavage products after restriction digest with the…

A: The type of restriction enzymes that cut double stranded DNA at a particular spot is known as…

Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…

A: It is related to molecular biology in which we use restriction enzymes an important tool for

Q: Now that you’ve isolated the gene and made lots of copies, you need to insert the gene into…

A: Plasmids are used in genetic engineering to increase the number of copies of a gene. A plasmid is a…

Q: plate your cells on a master plate without any antibiotics.  After colonies appear, you pick and…

A: Recombinant DNA technology is helpful for different gene related experiments.

Q: A plasmid vector has two genes in it, a gene for streptomycin resistance (strR) and another for…

A: Introduction :- Recombinant DNA technology ( also known as genetic engineering) involves the use of…

Q: The 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between…

A: Introduction: DNA is the type of nucleic acid that is the genetic material of the living body,…

Q: Amplified target regions of four different samples were separated using gel electrophoresis.  DNA…

A: Gel electrophoresis is a lab technique for separating DNA, RNA, and protein mixture based on their…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: Transposon mutagenesis

A: Transposons: These are also known as jumping genes. These are the segments of DNA which can move or…

Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…

A: DNA is the genetic material present in all living cells. It carries information from one cell to…

Q: Explain why DNA ladders are usually included during gel electrophoresis.

A: BASIC INFORMATION  GEL ELECTROPHORESIS  It is a process in which the DNA fragments are separated…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: In producing genetically engineered human insulin in bacteria, why is it important to use the…

A: Insulin is a natural peptide hormone produced by the beta cells of the pancreas in response to high…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: Primers designing for epitope tagging: Design forward and reverse primers to amplify the following…

A: Primers should generally have the following properties: 1. Length of 18-24 bases. 2. 40-60% G/C…

Q: DNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA…

A: Any human biological specimen taken or preserved for the purpose of extracting and analysing DNA in…

Q: The human gene for hemophilia is on the X chromosome. Below is a pedigree from a family afflicted…

A: Hi, Thanks For Your Question.  Answer : Correct Option Is b (20%) Explanation :  P (III-7 Is…

Q: To terminate a reaction in which a restriction enzyme cleaves DNA, researchers often add high…

A: Restriction enzymes are endonucleases that identify and cleave at specific sequences within DNA.…

Q: Assume that a plasmid is 4700 base pairs in length and has restriction sites for a given restriction…

A: A circular piece of DNA has four sites for a particular restriction enzyme, then that restriction…

Q: All of the following are performed during restriction fragment length polymorphism analysis. 1.…

A: DNA( Deoxyribonucleic acid) is basically a helical, twisted structure which comprises of two…

Q: Match the following Conjugation terms with the most appropriate description in the image: F-…

A: Introduction Conjugation Is The Transfer Of Genetic Material From One Bacterium To Another Through…

Q: An optimum ligation reaction should contain approximately 50 ng of vector. Given your concentrations…

A: It is given that an optimum ligation reaction should contain approximately 50 ng of the vector. We…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.