Q: How many 3 base sequences are in the Genetic Code? 12 20 22 64
A: The DNA code is read by the cell in three-base groups. Each codon, or triplet of bases, determines…
Q: A template DNA strand for transcription is 5' - GAG GTG AAA - 3' What is the resulting RNA sequence…
A: Step 1 Base pairing is formed in DNA (Deoxyribonucleic acid) double helix between purine of one…
Q: In the process of transcription
A:
Q: During transcription, 1 nucleotide of DNA corresponds with ________ nucleotide of RNA:
A: Answer: Transcription : It is the process in central dogma during which DNA is transcribed in to…
Q: You come across four polynucleotide strands. The first is an original RNA strand that codes for a…
A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…
Q: Which of the following is NOT a part of transcription? O Double-stranded DNA is unwound and forms a…
A: Transcription is the process of copying genes in DNA into mRNA sequence where they form…
Q: Describe the process of transcription. Your answer should be at least a full paragraph (3-7…
A: Question - Describe the process of transcription. Your answer should be at least a full paragraph…
Q: Assume that this DNA molecule is from a eukaryotic cell. Draw the approximate location of an RNA…
A: Step 1 The segment of the template strand which takes part in transcription is called transcription…
Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…
A: mRNA stands for messenger RNA which is a single stranded RNA molecule that is complementary to one…
Q: Energy that drives transcription is provided mainly by_____ . a. ATP c. GTP b. RNA nucleotides d.…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Q: What determines which base is to be added to an RNA strand during transcription? Base pairing…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: The site of transcription initiation is the promoter. sigma factor. start codon. origin of…
A: The gene expression involves transcription as its first step. This step involves the formation of…
Q: DNA methylation is associated with: OA gene repression. O B. neither gene transcription nor gene…
A: DNA Methylation is one of the processes of histone modifications that falls under the field of…
Q: What is the RNA sequence transcribed from the coding strand DNA with the sequence of 5’-ATGT-3’?…
A: Transcription is a process in which a particular segment of DNA is copied into RNA by the action of…
Q: RNA polymerase Il promoters are located on the side of the template strand a. internal b. C-terminal…
A:
Q: Which of the following is least related to the other items? A. RNA Polymerase B. transcription…
A: Transcription It is defined as the process of production of RNA sequence from the DNA sequence. The…
Q: ATP is produced in the process of replication. reproduction. transcription.…
A: Adenosine 5′-triphosphate, abbreviated as ATP and usually characterized without the 5′-, is a key…
Q: What is the maximum number of amino acids that can be encoded by a gene with 45 bases plus a stop…
A: The triplet code is comprised of three bases encoding for one amino acid. Thus, 15 amino acids can…
Q: A segment of a protein-encoding gene sequence is given below. 5'-AAGTTTGGCACT-3' 3'-TTCAAACCGTGA-5'…
A: Translation or protein synthesis is a process in which the genetic information present in m-RNA in…
Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…
A: RNA polymerase
Q: The transcription factor that unwinds DNA to expose the template strand Group of answer choices
A: The conversion of DNA's genetic information into mRNA takes place by a process known as…
Q: When pieces of DNA that were not originally from a bacterial cell get integrated into its…
A: Introduction :- Bacteria are prokaryotic organisms . They do not have a well defined nucleus and…
Q: Attached is a region of DNA containing a transcription unit. Match the boxes with the terms…
A: The DNA contained the genetic information that is transcribed into mRNA by the process of…
Q: A promoter: is a small stretch of DNA that binds to proteins that initiate transcription is a small…
A: A promoter is a small stretch of DNA that binds to proteins that initiate transcription.
Q: The coding sequence for gene F is read from left to right. The coding sequence for gene G is read…
A: The original DNA strand that mRNA is built from is called the template strand because it serves as a…
Q: What is the kind of protein that binds to DNA and changes the amount of transcription? A.…
A: Transcription is that the method by that the data during a strand of deoxyribonucleic acid is…
Q: The operator is the side of the DNA where ---- binds 1. Repressor 2. DNA polymerase 3. Ribosome…
A: INTRODUCTION An operator is a genetic sequence which allows proteins responsible for transcription…
Q: Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase ODNA…
A: Option 4 is the answer.RNA polymerase.
Q: Contains nitrogenous base and pentose sugar v One copy of all chromosqmes in cell DNA Nucleotide…
A: a)Nucleotide: Contains nitrogenous base, pentose, and phosphate
Q: Which of the following sequences could NOT be used as an anticodon in a cell? Question 41 options:…
A: Codons are present in mRNA .it is made up of 3nucleotides .tRNA has a anticodon loop which makes…
Q: If you had the RNA sequence below: 5' UUUGGAG 3' and you were going to make a piece of DNA that…
A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…
Q: Which of these mechanisms causes the TE to increase in number?
A: Transposable element(TE) basically refers to the DNA sequence capable of changing its location…
Q: What fraction of transcription in most human cells corresponds to non-coding RNAS? 20% 1096 100% 0%…
A: Non-coding RNAs (ncRNAs) capacity to direct quality articulation at the transcriptional and…
Q: Transcription factors are allowed to enter and exit the nuclease at all times. 1 A▾ B I U S X₂ x² $$…
A: The above statement is true.
Q: The process of transcription directly results in the synthesis ofa. DNA.b. RNA.c. a polypeptide.d.…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: The transcription factors would recognize and bind to nucleotides between the positions…
A:
Q: In which direction does RNA polymerase elongate a strand of RNA? O 3' to 5' 5' to 3' Both 5' to 3'…
A: During elongation , RNA polymerase elongate a strand of RNA in 5' to 3' direction. RNA polymerase…
Q: Describe the major steps involved in gene transcription. This answer must not exceed 1200 words.…
A: Answer: Introduction: Prokaryotic gene expression is regulated by two processes i.e. transcription…
Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…
A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…
Q: Which of the following would be present in a genome but not the transcriptome? (Select all) A)…
A: A transcriptome is the complete range of messenger RNA, or mRNA, molecules displayed by an organism.…
Q: What would the effect be on the protein you made if you made a mistake when you transcribed the DNA…
A: Point mutation Change of one base of nucleotide in DNA sequence is known as point mutation.
Q: The DNA strand opposite the template for transcription is known as the A. sense strand B. antisense…
A: Transcription is the process of transcribing genetic codes from one strand of DNA into RNA. To make…
Q: Put the following steps in the proces transcription in chronological order. RNA splicing [ Choose ]…
A: Initiation, elongation, and termination are the three stages of transcription.
Q: Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the…
A:
Q: The following is a prokaryotic DNA sequence. Fill in the other strand of DNA. Be sure to label the…
A: RNA polymerase synthesizes an RNA transcript complementary to the DNA template strand in the 5' to…
Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.
A: Transcription is the process in which RNA is made from DNA, while translation is the process in…
Q: Define the following terms: a. processivity b. replisome c. exonuclease d. DNA ligase e. replicon
A: DNA represents the genome of a variety of organisms and can exist in single-stranded or double…
Q: All of the following are involved in transcription excepta) polymerase. b) primer.…
A: Transcription is the process of synthesis of mRNA from DNA. One of the strands of the double…
Q: They have pol 8 and pol e They do not need to export the transcript out of a nucleus They add a 5'…
A: INTRODUCTION Prokaryotes are single-celled organisms. Due to the absence of internal membranes,…
Proteins
We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.
Protein Expression
The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.
The
1. -10
2. +1
3. -35
4. 0
5. -1
Step by step
Solved in 2 steps
- If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleIf we have the following mutations, find the type of the mutation (silent or missense or nonsense?)c.17CUc.36GAc.49GUc.115AC
- A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex. Knowing that this virus transcribes its own mRNAs in the cytoplasm of human cells, why would Protein X be an effective virulence factor?Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino AcidCystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR. Studies of this gene have found that the Gene includes 250,000bp in the DNA. Scientists found that the mRNA had 6,500 nucleotides, and the final protein had 1480 amino acids. How much of the mRNA is untranslated? How much of the RNA that is produced does not leave the nucleus? One of the mutations that results in a disease phenotype can be easily identified because the mutation results in a much longer mRNA then normal. Where would you look for this mutation? What might this mutation have affected?
- In this problem, just put the order of the intermediates on the pathway, starting with P and ending with Z and explain your reasoning. (So to get you started, notice the class 1 mutants—and there is only mutant in this class, which is mutant #5—won’t grow on minimal medium, but will grow if you give it substance Z. However, giving it substances, p, w, x, or y won’t help. This means that the gene that is mutated lies on the pathway in a place that the Z substances is to its right and all the other substances are to its left. The easiest next one to look at is the line with 2 pluses, and then the line with 3 pluses, and then the line with 4 pluses).Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart on the next page to answer the following questions. Partial gene sequence of DNA nucleotides: A C C T T A A T G A A C T C T 42. What is the mRNA nucleotide sequence that would result from transcription of the partial gene sequence of DNA nucleotides? 43. What is the protein amino acid sequence resulting from translation of the mRNA sequence from the previous question? 44. In the gene sequence of DNA nucleotides, guanine (G) is mistakenly replaced by adenine (A) during DNA replication. What type of mutation would this be considered based on how it occurred? ________ a) spontaneous b) gametic c) mutagenic d) carcinogenic 45. Consider the mutation from the previous question. If it occurred within a skin cell of the body, what type of mutation would this also be considered based on where it occurred? ________ a) gametic b) germline c) heritable d) somaticTranscription factors bind to: Question 20 options: DNA regions called cis-acting elements RNA regions called trans-acting factors DNA regions called trans-acting elements RNA regions called trans-acting elements RNA regions called cis-acting elements
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’ture.com/courses/132776/quizzes/489888/take O Ribosome Question 22 22. During transcription, what does messenger RNA do? O It strings together two complementary RNA strands O It strings together two complementary DNA strands O It constructS proteins out of random amino acids O It delivers DNA's Instructions for making proteins Question 23A.C. 3.4 Q1. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC First base (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. U U UUU Phenyl- UCU UUC alanine F UCC UCA -Leucine Lucc UUG-Le G CUU CUC CUA CUG A AUA -Leucine L AUU I AUC Isoleucine Methionine start codon AUG MMet GUUT GUC GUA GUG -Valine V CCU CCC CCA CCG ACU ACC ACA ACG C GCUT GCC GCA GCG Second base -Serine S -Proline P -Threonine -Alanine UAUT UAC A UAA UAG CAU CAC CAA CAG A Tyrosine Y Stop codon Stop codon -Histidine H -Glutamine AAA TAAG-Lysine AAC-Asparagine N GAU Aspartic GAC acid D GAG Glutamic G UGU-Cysteine C E UGC UGA UGG AGU AGC KAGG-Arginine CGUT CGC CGA CGG GGUT GGC GGA GGGJ Stop codon A Tryptophan -Arginine R Serine S R Glycine UCAG G SCAG SCAQ SCAG Third base