The +1 site is located in the... Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a b с d DNA mRNA both A and B none of the above

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: QUESTION 15 Which of the following is true regarding pre-mRNA modifications/processing? A The 5 cap…

A: Genes follow central dogma, according to which DNA (deoxyribonucleic acid) is transcribed to mRNA…

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: How to identify the start site for transcription

A: The genome or genomic data of an organism refers to the complete set of its hereditary material…

Q: Which of the following is an example of a post-translational modification? Select an answer and…

A: Post-translational modifications (PTMs) are chemical modifications that occur on a protein after it…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: describe a scenario (as you would to a 12th grader) a physiological situation (protein need) that…

A: CENTRAL DOGMA-  Replication is the process when DNA replicates itself means it will make copies of…

Q: The 5' cap of TOP mRNAs can be bound by (choose all that apply) i Multiple answers: Multiple answers…

A: Explanation: The 5' cap is important for mRNA stability and translation. It can be bound by…

Q: The residual end of a pre-mRNA transcript is digested by the following enzyme

A: Transcription is the process of formation of pre-mRNA (precursor mRNA) (heterogenous mRNA) from the…

Q: Below is the RNA sequence of a primary transcript. Underline (or highlight) each intron, and then…

A: The primary transcript of RNA sequence contains both introns and exons. Introns are generally spiced…

Q: Eukaryotic mRNAs have a 7-methylguanosine cap on their5' end. true/ false

A:

Q: Which of the following enzymes is NOT utilized in mRNA degradation? MARK ALL THAT APPLY Primase Poly…

A: Transcription: It is processed to convert DNA into RNA. It is part of the central dogma. It is…

Q: When chromosome condensation occurs, transcription stops. Select an answer and submit. For keyboard…

A: Transcription is the process of translating information from one form into another. In biology, it…

Q: D. Evaluation (Pagtataya) • Fill in the pill-shaped bubbles in the flowchart using the terms in the…

A: This is the description of gene expression in which a part of the gene is expressed into a…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The most common type of gene control is at the level of ________________.   A transcription   B…

A: The genes are the functional parts of the DNA that are responsible for the production of a specific…

Q: write a correct terminology/word on column B that meet the description of column A COLUMN A COLUMN…

A: Ribosomes-are minute particles consisting of RNA and associated proteins that function to synthesize…

Q: The sigma subunit of bacterial RNA polymerase ________________________.   is required for the…

A: RNA polymerase "core" from E. coli consists of five subunits: two alpha (α) subunits of 36 kDa, a…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…

A:

Q: DNA Repiica TCC cca GTA GAC ATT TTA TTG CCA GTC AAT AAC GcC TTT TTC CAC AGA TAT ACA тот MRNA Strand…

A: DNA is converted into mRNA by transcription. mRNA has the codons, complementary sequence of the DNA…

Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…

A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the…

A: Genetic codes are stored in the form of trinucleotide sequences (codons) in the mRNA.The mRNA gets…

Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…

A: Transcription and translation are key forms in molecular science that convert the hereditary data in…

Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…

A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: The process of translation in involves three steps - (A) Initiation: it involves binding of a small…

Q: Attached is a region of DNA containing a transcription unit. Match the boxes with the terms…

A: The DNA contained the genetic information that is transcribed into mRNA by the process of…

Q: The figure shows the position of two of these mutations a and b. The nucleotides are altered in…

A: Note: Your question has 4 sub parts and as per our instructions we ara able to answer only three.…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: transcription should be done from the 5' DNA chain. 1. a. 3' DNA: b. 5' DNA: c. mRNA: d. Amino…

A: This exercise involves the process of replication, transcription and translation. In the process of…

Q: Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of…

A: Mutation is the change in the genetic makeup of the organism, mutation particularly in the genes can…

Q: Why is there some signal present within the ‘no sugar’ and other noninducing sugars for the green…

A: The arabinose promoter is a special type of DNA sequence that controls the expression of genes in…

Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…

A: The process of transferring genetic information from the DNA into the RNA molecule is called…

Q: Below is the sequence of MRNA. 1. if U is mutated to C, then it will lead to a [ Select ) mutation.…

A: Answer :- 1. UGU (Cys) is converted to UGC (Cys) - silent mutation

Q: The promoter is a stretch of nucleotides found in the Select an answer and submit. For keyboard…

A: DNA is a type of nucleic acid and it is the genetic material in living organisms. It is a double…

Q: Transcribe the following DNA sequence from HbS. Record your answer to submit for grading. DNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: How does polio (poliovirus) get more than one protein from a single mRNA? Give typing answer with…

A: Polio is an life threatening disease that affects the brain stem or spinal cord and results in…

Q: From the list below, which would be true if you expressed a eukaryotic gene in a bacterial cell?…

A: The bacterial transcriptional machinery does not have post-transcriptional modifications like…

Q: What would the sequence of the immature mRNA be? Place the sequence of ALL the transcript that would…

A: Some genes do not synthesize protein by utilising the entire DNA sequence. Introns are non-coding…

Q: SİRNA MISSION shRNA Clone cell membrane Nucleus A degraded MRNA wwwww

A: Answer - The component labeled 'A' is RISC.  RISC stands for RNA Induced Silencing Complex. It is…

Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An…

A:

Q: What is the mRNA transcribed from the "anti-sense" strand of this DNA shown below? 5' TATGGC 3'.…

A: Given: Messenger RNA (mRNA), a molecule in cells that carry codes from DNA in the nucleus to areas…