13.Which lane or lanes on the gel could be the result of Mutation C? TATAAAUGUAAOnly knownregulatoryregionTSSMutation B:Mutation C.20 nucleotides3 nucleotidesA: 5-basedeletiondeletedchangedN 1 2 34 5

Name: 13.Which lane or lanes on the gel could be the result of Mutation C? T
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 13.Which lane or lanes on the gel could be the result of Mutation C? TATAAAUGUAAOnly knownregulatoryregionTSSMutation B:Mutation C.20 nucleotides3 nucleotidesA: 5-basedeletiondeletedchangedN 1 2 34 5

Mutations are the changes in the DNA sequence that may or may not have an effect on gene function…

Answered: TATAA AUG UAA Only known regulatory…

Science

Biology

TATAA AUG UAA Only known regulatory region TSS Mutation C. 3 nucleotides Mutation B: 20 nucleotides A: 5-base deletion deleted changed N 1 2 3 4 5

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter4: Cell Structure

Section: Chapter Questions

Problem 43CTQ: Pathogenic E. coil have recently been shown to degrade tight junction proteins during infection. How...

See similar textbooks

Related questions

Q: The following represents a DNA strand in the process of replication. The bottom sequence is that of…

A: DNA replication is the process in which a copy of already existing genome is formed. A pair with T…

Q: 3)What would be the third amino acid produced by the DNA strand: T A C C G A G T C A C G (Hint: use…

A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…

Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…

A: According to the question, we have seen a diagram, where we have to transcribe the two new…

Q: 1. What are the new DNA sequences and the corresponding new amino acid sequences of these two…

A: Any change in the DNA sequence is known as mutation. Usually two types of mutations are found that…

Q: 6. Which side of the DNA strand is read 3' to 5'?

A: DNA (Deoxyribonucleic acid) is a double helical structure present in nucleus of a cell and contains…

Q: . the position that distinguishes between DNA and RNA is 2. the carbon that the phosphate group…

A: 1. The position that distinguishes between DNA and RNA is A sugar called ribose is found in RNA,…

Q: Describe the relationship between chromosomes, cells, and DNA 2. [Use Pictures] - How does…

A: The genetic information necessary for an organism to develop and operate is carried by the molecule…

Q: 1. One strand of DNA has the base sequence: CGATTGGCAGTCAT. Determine the sequence of bases in the…

A: The sequence of bases of complementary mRNA from DNA strand can be determined as follows: DNA mRNA…

Q: 7. Which is the main enzyme used for the replication of DNA in E. coli ?

A: Deoxyribonucleic acid (DNA) refers to the macromolecule that is made of nucleotides. A nucleotide…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: 10. Which statement is true about gene transcription? A. Every gene that is present in the genome is…

A: Introduction: Transcription, is the process of the making an RNA copy of a gene's present on DNA…

Q: 1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA…

A: The answers are:(a) Template Strand:3' - G T A T A T C A G T T A G A G C T A A T C - 5' Non-template…

Q: . what is A single gene mutation that affects multiple properties of an organism?

A: Need to find the gene mutation that affects the multiple properties of an organism. There is a…

Q: 14. Define biotransformation. Explain the mechanism of biotransformation.

A: Biotransformation, also known as metabolism or biodegradation, is a vital process in which the body…

Q: 3 & 4. Identify the labelled structures:

A: The human brain serves as the operational center for the human sensory system. It gets signals from…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

13.Which lane or lanes on the gel could be the result of Mutation C?

TATAA
AUG
UAA
Only known
regulatory
region
TSS
Mutation B:
Mutation C.
20 nucleotides
3 nucleotides
A: 5-base
deletion
deleted
changed
N 1 2 3
4 5

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Answer

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
HN, NH. NH H2N° А. В. Consider the 3 structures shown. Which of these is (normally) NOT present in either DNA or RNA? (select all that apply) А В none of the above ZI C.
Enumerate all the possible DNA nucleotide base sequence for the amino acids given.
Sickle cell hemoglobin DNA CA CG TAGACTGAGGACA C Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence ValoHis.lku thro proo Gily 4. What type of mutation is this? Please explain why.
What is the monomer for dna
10:39 E DNA/RNA/PROTEIN SYNTHESIS/M... 18 of 20 A DNA nucleotide is composed of what three parts and are held together by Phosphate, ribose, nitrogenous base and held together by hydrogen bonds Phosphate, deoxyribose and held together by hydrogen bonds Phosphate, ribose and held together by covalent bonds Phosphate, deoxyribose, nitrogenous base and held together by hydrogen bonds Next > II
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent genes, the "-" represents the centromere of each chromosome, and chromosomes are shown on separate lines. ABCDE-FGHIJK 123-45678 Identify the type of rearrangement shown in each of the following (A-C) and then identify whether it is balanced or unbalanced. Assume that the individual is diploid and heterozygous for the rearrangement. A. • ABCDE-FGHIJKGH 123-45678 Rearrangement: [Select] • Balanced or Unbalanced: [Select] B. • ABCDGF-EHIJK 123-45678 Rearrangement ✓ [Select] • Balanced or Un pericentric inversion Robertsonian translocation deletion tandem duplicate paracentric inversion C. reciprocal translocation ABCDE dispersed duplicate nonreciprocal translocation 123-45
25
Stiffening of the arteries, joints, and lensesin old age may be a result of cross-linkingbetween ______ molecules
Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letter
A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5' AUGCAGUGCAAUCCUGCA 3' 2. 5' AUGCAGUCCAAUCCUGCA 3' 3. 5' AUGUAGUGCAAUCCUGCA 3' 4. 5' AUGCAGCUGCAAUCCUGCA 3' 5. 5' AUGCAGUGUAAUCCUGCA 3'