Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio of C and G nucleotides (3C:1G ratio). If you were to use the resulting RNA to synthesize protein in an in vitro translation system, what percentage of the total amino acids in the protein would be made up of arginine (Arg)? 18.75% 14% 0% 56.25% 6.25%
Q: Which of the following is incorrect about the glycerophospholipids? a. They are not amphipathic Ob.…
A: GlyceroPhospholipids are the important components of biological membranes. They are diglycerides and…
Q: Family B Generation 1 Female 1 Absent Male 1 Morton's Toe Generation 2 Female 1 Morton's Toe married…
A: The pedigree chart will clearly show the occurrence of any trait or disease in different…
Q: What property is exhibited by proteins which allows them to absorb large quantities of water?…
A: Proteins are organic molecules composed of amino acids. The polar nature of proteins makes them…
Q: You take the PKA catalytic subunit, the regulatory subunit, and the dimerization domains and mix…
A: As given in the question; the regulatory, catalytic and dimerisation domains of PKA were taken in…
Q: Differentiate the levels of protein structure from primary to quaternary.
A: Proteins are biomolecules composed of amino acids. The amino acids are joined together through…
Q: Q38 (1.5): In the diagram, what does the plane draw behind the peptide bond indicate? Ca N H H R
A: A polypeptide is a long chain of amino acids linked via peptide bonds. A peptide bond is the bond…
Q: Coenzyme A, NAD*, and FAD are coenzymes that are necessary for energy production. Classify each…
A: NAD+, FAD are important for oxidation reduction reactions in metabolic pathways. They act as…
Q: Indicate what will happen ( increase, decrease or no effect) tothe activity of the enzyme or rate of…
A: Metabolism refers to the anabolism as well as catabolism of biomolecules including lipids, proteins,…
Q: Digestive enzymes and end products of digestion of each biomolecules
A: Carbohydrates, lipids, and proteins are the biomolecules that are obtained through the diet. These…
Q: Activity 2: Determine the volume from micropipette reading Write down the correct volume for each…
A: Micropipette are the tools used for measuring, transfering a very fine volume in the range of…
Q: Tests Leukocytes Nitrite Urobilinogen Protein pH Blood Specific G. Ketone Bilirubin Glucose Unknown…
A: The urine analysis details of two unknown samples (A and B) are given. The interpretations for…
Q: Which of the following is incorrect about the glycerophospholipids? a. They are not amphipathic Ob.…
A: Glycerophospholipids are glycerol-based phospholipids
Q: Which of the following is incorrect about the first phase of glycolysis? O a. None; all the other…
A: Glycolysis is initiated with one molecule of glucose and yield two pyruvate molecules, four ATP…
Q: Why is fetal hemoglobin’s affinity for O2 greater than that of maternal hemoglobin?
A: Fetal hemoglobin is different than that of the mother's hemoglobin. The affinity of hemoglobin is…
Q: 10. Vitamin C function as (a) Antioxidant (b) collagen synthesis (c) healing of wounds (d) All of…
A: Introduction: Vitamin C is a water soluble vitamin. It is usually found in citrus fruits. Another…
Q: Which of the following is incorrect? a. Regulatory steps are irreversible O b. Regulation of a…
A: Regulatory steps are the important steps in a metabolic pathway which are slowest and they can be…
Q: Compare and contrast triacylglycerols and phospholipids. Discuss the biological roles these…
A: The biological macromolecules can be classified as carbohydrate, lipid, proteins and nucleic acids.…
Q: The role of Zn2+ in catalysis is usually to: a. Stabilize a (-) charge in the transition state Ob.…
A: Proteins include zinc, which is either essential for preserving protein stability and structure or…
Q: In urea assay (Catalog #K375-100) what is the nmol (range) it can detect?
A: Urea assay (catalogue #K375-100) is a colorimetric assay used to quantify the urea in any given…
Q: The master formula for preparation of a ganciclovir solution is: Ganciclovir 500 mg injection vial 1…
A: Each vial contains 500 mg of ganciclovir. After 10 mL additions each of the vials gives 50 mg.
Q: 6. Below are two bar graphs. One represents the ratio of saturated to unsaturated fatty acids…
A: Saturated fatty acids are the fatty acids without double bonds in the hydrocarbon chain. Unsaturated…
Q: You obtained the following raw data when setting up a Bradford standard curve: BSA (mg/ml) 0 1 2 3 4…
A: Bradford protein assay is a technique used to measure the concentration of a total protein in a…
Q: Using a simplified series of diagrams describe how a cell can extract 38 molecules of ATP(net)from…
A: Using a simplified series of diagrams describe how a cell can extract 38 molecules of ATP(net)from…
Q: Differentiate the lock-and-key model from the induced fit hypothesis
A: In biochemistry the enzymes catalyze chemical reactions and the substrate is a molecule upon which…
Q: Residue Asn 204 in the glucose binding site of hexokinase IV was mutated, in two separate…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: What type of reaction is the third step (formation of keto group from a secondary alcohol) of fatty…
A:
Q: Give a clear handwritten answer with explanation.....give detailed answer. what is standard amino…
A: Proteins are a class of complex macromolecules essential for the human body. Proteins are formed by…
Q: Write down the values in bold print. You are isolating a protein with a pl of 8.5 using cation…
A: As given in the question, a protein with pI of 8.5 was isolated using cation exchange…
Q: The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two…
A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…
Q: Answer for the Number 5 question . Thank you. no need for a long explanation.
A: GPCR (G protein coupled receptor) is a cell surface receptor that binds to ligand molecules such as…
Q: Which of the following statements about enzymes are true? Choose all that apply. Group of answer…
A: The enzymes are biological catalysts that enhances the rates of biological enzymes. Most enzymes are…
Q: Human Response to Cold Temperatures 2. Hypothermia: In hypothermia, the body temperature is lowered…
A: The human have multiple physiological responses to combat the cold weather so that maintain the…
Q: ch of this is NOT a correct interpretation of KM? It is substrate concentration required to reach…
A: Enzymes increase the rate of biochemical reactions by converting the substrate molecules into…
Q: Almost all amino acids are chiral. The body only uses L amino acids, and proteins are chains of…
A: Amino acids normally found in protein has L-configuration. The presence of L-amino acids has been…
Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…
A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…
Q: In glycolysis, pyruvate kinase produces what high energy product and what low energy product?
A: Glycolysis is a pathway in which the Glucose (C6) is broken down into a 3 carbon product i.e. 2…
Q: Match the nephron structure with its correct description. cap-like structure at the top of each…
A: Nephrons are the structural and functional units of human kidney. There are approximately 1 million…
Q: Match amino Acid R group characteristics to the biochemical bond it can form. Alanine ◆ Glycine ◆…
A: Alanine C. Non-polar bonds Glycine I. No-R group - highly flexible Proline E. Inserts a…
Q: You are the CEO of a drug company where you've asked five teams of scientists to generate new drugs…
A: Blood pressure is the force that circulating blood exerts on the walls of arteries. Blood pressure…
Q: Which of the following is incorrect? O a. Metabolic pathways involve mostly intermediates or…
A: Metabolic pathways are very important for a cell to provide energy.metabolic pathways might be…
Q: Che mi c al Reaction water+ reactants enzymes 42. If the reactants are lipids, then the products are…
A: Since the second question is an incomplete question because one of the options is cropped, we will…
Q: How many ATP molecules would be generated if an 8-carbon fatty acid were metabolized solely by the…
A: The citric acid cycle (also known as the Krebs Cycle) is a portion of the much larger process known…
Q: C. 2 mM
A: Option C is the correct answer. By using the Michaelis-Menten Equation, we get the answer
Q: Write down the values in bold print. You are isolating a protein with a pl of 8.5 using cation…
A: As given, protein of interest has pI of 8.5 which was isolated using cation exchange chromatography.…
Q: Which of the following is incorrect about the G protein signaling pathways? a. The binding of the…
A: The guanine nucleotide-binding protein (G-protein) cell signaling pathway is involved in many…
Q: 3. Briefly discuss the molecular aspects of effector mediated receptor responsiveness in relevant…
A: An effector is any molecule that can bring about a physiological or biochemical response within or…
Q: From the various reactions you have learned in catabolism of amino acids; list three reactions in…
A: Catabolism of proteins releases amino acids which composed of mainly two parts-amino nitrogen (in…
Q: Which of the following are considered predominantly catabolic metabolic pathways? (Choose all…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: If 32P labeled (radioactive phosphate) inorganic phosphate were introduced to erythrocytes…
A: Glycolysis converts glucose into pyruvate or lactate with the generation of energy. The process of…
Q: Which of the following are properties of membranes? Electrically polarized Hydrophobic exterior…
A: The cell membrane is principally composed of a lipid bilayer. The membrane is selectively-permeable…
18.75% |
14% |
0% |
56.25% |
6.25% |
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 4 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio of C and G nucleotides (3C:1G ratio). If you were to use the resulting RNA to synthesize protein in an in vitro translation system, what percentage of the total amino acids in the protein would be made up of alanine (Ala)? 56.25% 6.25% 18.75% 0% 14%The ribonucleotides C and G we're mixed together with C two times more abundant than G. The resulting RNAS we're translated in a cell free system. Give the amino acids and the relative percentages of each that would be found after the translation. Show all reasoning/calculations. Suppose that di-ribonucleotides (GC) were used to make RNA and then translated in vitro. What would the results be- explain all reasoning and explain how this information could be combined with the information in part A above to try to deduce the genetic code, assuming you didn't already know it.(a) The average molecular weight of proteins in the cell is about 30 kDa. The largest known polypeptide made by any cell is a protein called titin (made by muscle cells), and it has a molecular weight of 3 MDa (3,000,000 daltons). Estimate how long it would take to translate an mRNA coding for titin (assuming an average mol. wt. of an amino acid to be 120 Da, and a translation rate of two amino acids per second for eucaryotic cells).(b) Transcription occurs at a rate of about 30 nucleotides per second. Is it possible to calculate the time required to synthesize a titin mRNA from the information given in this problem (including part a)? Explain your answer.
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.The average molecular weight of a protein in the cell is about 30,000 daltons. A few proteins, however, are much larger. the largest known polypeptide chain made by any cell is a protein called titin (made by mammalian muscle cells), and it has a molecular weight of 3,000,000 daltons. estimate how long it will take a muscle cell to translate an mRNA coding for titin (assume the average molecular weight of an amino acid to be 120, and a translation rate of two amino acids per second for eukaryotic cells).Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-LysA random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a 5:1 molar ratio stimulated the incorporation of proline, histidine, threonine, glutamine, asparagine, and ly- sine in a cell-free translation system in the following proportions: 100, 23.4, 20, 3.3, 3.3, and 1.0, respectively. What does this experiment reveal about the nucleotide composition of coding triplets for these six amino acids?
- Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The template DNA strand will have the following sequence written in the conventional manner with no orientation indicators: The corresponding tRNA sequence written in the conventional manner with no orientation indicators will be: After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, the sequence of the resulting polypeptide is
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)