State three major differences between the structures of DNA and RNA
Q: Is it true or false that both prokaryotes and eukaryotes havr DNA inside a membrane-bound nucleus
A: Cell is the basic fundamental unit of life that can exist as a singular unit or it can combine with…
Q: In addition to identifying the genetic material, the experiments of Avery and colleagues with…
A: The existence of DNA as genetic material can be proved by the facts such as: the total DNA content…
Q: The technique of dideoxy sequencing of DNA is described inChapter 20. The technique relies on the…
A: Introduction DNA is composed of the nucleotides arranged in a specific sequence. Prior knowledge of…
Q: Identify three discoveries listed above that were essential in determining the structure of the DNA…
A: The structure of DNA was given by two scientists known as James Watson and Francisco crick.
Q: In the early 1940s, Oswald Avery and his team set out to identify the conditions necessary for…
A: Big and complicated macromolecules play an important part in the functioning and regulation of our…
Q: Prokaryotic DNA and prokaryotic RNA differ from each other in all of the following ways except:…
A: The nucleic acids deoxyribonucleic acid (DNA) and ribonucleic acids (RNA) are responsible for coding…
Q: scientist wants to clone a molecule uniProtKB accession number P43657. How will be come to know…
A: The database which is used free to find the protein sequence and functions are called UniProt. It…
Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…
A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…
Q: Explain how cells activate nucleic acids for polymerization.
A: Nucleic acids are polymers themselves. A macromolecule such as a nucleic acid or protein is…
Q: A new graduate student in a laboratory was tasked to synthesize a pentapeptide (a molecule composed…
A: DNA is the genetic material, it is highly stable and a self-replicating molecule. The replication of…
Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......
A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…
Q: How Can Fragments of DNA Be Separated From One Another? Agarose gel electrophoresis is a procedure…
A: Note- as we are allowed to only 3 subparts of a question, i can provide answers for first three…
Q: Describe in detail the semi Conservative replication of the DNA double helix structure
A: Earlier, it was proposed that DNA replication in an organism could occur in three ways following the…
Q: An analysis of the genetic material of an unknown sample showed that it contains 1996 adenine bases,…
A: Friedrich Miescher discovered nucleic acids from the nuclei of pus cells and coined the term…
Q: Nucleic acids involved in protein synthesis include DNA sense strand DNA anti-sense strand mRNA…
A: Nucleic acids are composed of phosphoric acids, sugars, and mixtures of organic bases like purines…
Q: Phosphorus is required to synthesize the deoxyribonucleoside triphosphates used in DNA replication.…
A: DNA replication is a semi-conservative process in which newly synthesized double helix DNA consists…
Q: The introduction to this chapter, which describes the sequencing of 4000-year-old DNA, emphasizes…
A: The cell is a fundamental unit of life. Within its nucleus lies the genetic material which is the…
Q: 1 bp of DNA is approximately 0.34 nm in length. Abacterial chromosome is about 4 million bp in…
A: Bacteria are microorganism that most commonly occur in the soil, air, water and in adverse…
Q: The DNA extract in this experiment is considered to be “crude” since it has not been separated from…
A: Cellular proteins which are bound to the DNA is removed by adding a protease, or it is removed by…
Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…
A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.
Q: Lagging strand synthesis in prokaryotes leads to two main problems: 1. Presence of multiple RNA…
A: Lagging strand synthesis in prokaryotes The polymerase 3 catalyses the synthesis of both the…
Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: Discuss the differences between the Z-Form, A-form and B-form Dna
A: DNA (Deoxyribonucleic acid) is a molecule which is present in the nucleus of the cell. It contains…
Q: A-DNA is a double-stranded form of DNA that has a helical radius and helical pitch compared to the…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Unusual nucleotides, like ribothymidine and dihydrouridine, can normally be found in which of the…
A: Nucleotides are the monomeric units of the genetic material that forms the nucleic acid structure.…
Q: The DNA of prokaryotes differs from that of eukaryotes in that the prokaryotic DNA is…
A: Exposed directly to the cytoplasm of the cell are correct option
Q: The DNA extract in this experiment is considered to be “crude” since it has not been separated from…
A: DNA is our genetic material and have been subjected for studies . it is important to extract pure…
Q: Quantification of DNA can be done by using a Nanodrop, a UV spectrophotometer, by measuring its…
A: The formula given for determining the dsDNA concentration is give as: dsDNA concentration= 50 μg/ml…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…
Q: One strand of a double-helical DNA has the sequence (5′)GCGCAATATTTCTCAAAATATTGCGC(3′). Write the…
A: The complementary strand is (5')GCGCAATATTTTGAGAAATATTGCGC(3') (sequence of a single strand is…
Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…
A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…
Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…
A: Complementary DNA Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…
Q: Nucleic acids: features of structural organization, biological functions of DNA and RNA.…
A: Nucleic acids are the polymer of nucleotides Nucleic acids are of two types: RNA and DNA
Q: Describe the complementary, antiparallel, double-stranded structure of DNA.
A: DNA or Deoxyribonucleic acid is considered as the genetic material that contains all the hereditary…
Q: DNA isolated from an organism can be sheared into fragments of uniform size (∼1000 bp), heated to…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…
Q: What observations are consistent with the conclusion that DNA serves as the genetic material in…
A: The organisms are primarily categorized based on their cell type. The prokaryotic organism lacks…
Q: Electrophoresis is an extremely useful procedure when applied to analysis of nucleic acids as it can…
A: Gel electrophoresis is a technique that separates the macromolecules based on their mass and charge.…
Q: Which of the following properties of DNA structure is the same in all species that contain this…
A: DNA also known as Deoxyribonucleic acid is a molecule which contains the instructions an organism…
Q: The amino acid sequences of a yeast protein and a human protein having the same function are found…
A: The amino acid is the smallest monomer of the polypeptide chain, which is coded by the mRNA. The…
Q: The complementarity of its two strands is the underlying reason that DNA can be faithfully copied.…
A: DNA replication is a process in which two DNA molecules are synthesized from a single DNA molecule.…
Q: Double-stranded regions of RNA: a. are less stable than double-stranded regions of DNA. b. can be…
A: RNA (ribonucleic acid) is a type of nucleic acid that is composed of ribose sugars, nitrogenous…
Q: RNA nucleotides can undergo versatile base pairing. What does this mean, and what is the consequence…
A: There are four nucleotides present in RNA and they are adenine, guanine, cytosine and uracil which…
Q: Topic: Nucleic Acids (DNA) Explain “the two strands are antiparallel”.
A: DNA is a deoxribonucleic acid which is a complex molecule present in all living cells. It stores…
Q: The base composition of the DNAs from many organisms, especially microorganisms, varies widely. Yet…
A: The proteins are the final product of a gene that is made up of amino acids that are bonded together…
Q: we have focused on DNA, the molecule that stores genetic information in all living things. In…
A: Introduction In the past years when the genetic and molecular biology techniques were not so…
Q: Scenario from pre class: Initial analysis of the Mars sample reveals the presence of eukaryotic,…
A: DNA or deoxyribonucleic acid is the genetic material consisting of nucleotide bases like adenine,…
Q: Much of the human genome consists of repetitious DNA. Describe the difference between microsatellite…
A: Some of the similarities between microsatellite and minisatellite are that both are type of tandem…
Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…
A: NOTE-"As per our honor code, we are authorized to answer only one question at a moment. As you have…
ISOLATION AND CHARACTERIZATION OF
- State three major differences between the structures of DNA and RNA
- Give at least two differences between prokaryotic and eukaryotic DNA’s
Step by step
Solved in 2 steps
- DNA contents of nitrogenous bases • %A = %T %C = %G • A+G = C+T %3D Example: if 35% of the bases of a DNA - molecule is thymine what the % of Cyosine?What is the role of GelRed® in Agarose gel electrophoresis of DNA fragments? Please select the single answer that is most correct GelRed® moves down the agarose gel in response to the electric current and enables visualisation of the position of A the nucleic acids within in the agarose gel. GelRed® intercalates with the Nucleic acid and, under UV light, fluoresces to enable visualisation of the position of the nucleic acids in the agarose gel. GelRed® intercalates with the Nucleic acid and enables visualisation of the position of the nucleic acids in C the agarose gel. GelRed® intercalates with the amino acids in the agarose gel and enables visualisation of the position of their in D the agarose gel.What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
- DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCCBriefly explain (1) the structure characteristics of DNA, (2) why different DNA molecules (i.e., with different sequences) could adopt the same B-form double helical structure, and (3) how certain proteins could recognize the specific sequences with the common B-form DNA.Quantification of DNA can be done by using a Nanodrop, a UV spectrophotometer, by measuring its absorbance in units of optical density (OD) (see “Nanodrop Microvolume Quantitation of Nucleic Acids" video in Lab 3 on Laulima). DNA absorbs light most strongly at the ultraviolet wavelength of 260 nm. The absorbance of double stranded DNA (dsDNA) at 260 nm (A260) is used to estimate concentration, with 1.0 OD equal to a dsDNA concentration of 50 µg/ml. Using this information we can calculate the concentration of dsDNA in our extractions using the following formula: dsDNA concentration = 50 µg/ml x OD260 x dilution factor Using the formula provided above, calculate the concentration of dsDNA in an extraction that was diluted 20X and had an A260 reading of 0.64 OD. Show your work
- The formation of a double-stranded structure must obey the rule that adenine hydrogen bonds to thymine (or uracil in RNA) and cytosine hydrogen bonds to guanine. Discuss reasons why complementarity is an important feature of DNA and RNA structure and function.Compare the DNA binding modes of minor groove binding, intercalating, and crosslinking agents and explain how these interactions give rise to specific pharmaceutical applications. Use the molecular structures of at least one DNA PLEASE DISCUSS THIS IN DETAIL! and correct answers only ! will give good rating! thank you.Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (32) (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D). 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT