Some silent mutations have been found to be associated with disease. Suggest a possible mechanism for this. How would you test this hypothesis?
Q: Different types of lipids with examples
A: Introduction Lipids are organic substances with atoms of hydrogen, carbon, and oxygen that serve as…
Q: What do you think would happen if 0.5M K+ was used first to elute the sample in an ion exchange…
A: The ion exchange chromatography matrix is made up of positively and negatively charged ions.…
Q: How does a healthcare facility manage childhood lead poisoning, by assuring minimal loss of public…
A: By identifying children who are more likely to become lead poisoned, evaluating their blood lead…
Q: If the TD50 of a drug is 20 mg, it means that: Answers A-D A 50% of patients experience toxicity at…
A: In toxicology, the toxicity and therapeutic effects of the drug must be analyzed before finally…
Q: A few finches from the mainland get caught in a strong wind and end up colonizing a new island.…
A: Hardy Weinberg (HWE) principle – In HWE the genotype frequencies and allele frequencies of a…
Q: Can the carbohydrate enzymes be genetically engineered
A: Genetic engineering used in gene therapy, manufacturing drugs etc.
Q: Factors affecting enzyme activity
A: Enzymes Enzymes are the biological catalyst that reduces the activation energy needed for starting…
Q: As you are performing this protocol, you realize that the ultraviolet (UV) light does not work as…
A: Introduction A gene is a DNA segment that encodes for protein or RNA (ribonucleic acid). It is the…
Q: Many different alleles of a gene may exist in a population, yet each individual within the…
A: Mutations are changes in an organism's DNA sequence. The health of an organism can be significantly…
Q: Explain in detail the mechanical and chemical processes that render a chunk of cheese (containing…
A: Digestion is the main physiological process by which the food we ingested and converted into small…
Q: Do you believe in Natural Selection? Why or why not?
A: Natural selection is a force that drives the process of evolution.
Q: A drug with an intrinsic activity of 0.2 is best classified as a/an: Answers A-D A full agonist B…
A: Intrinsic Activity- it is the activity which refers to the maximal possible effects which can be…
Q: 3. Why are celluloses often used as supports to separate large biologically active proteins?
A: Introduction Cellulose is a polymer composed of long chains of beta glucose molecules that are…
Q: Which of the following are supported explanations for the evolution of complex traits? A)…
A: Introduction Evolution is the gradual change in the inherited traits of biological populations over…
Q: A specific DNA segment, which we later learn has the sequence of 5' AGCTGAGTCAGCT 3', fails to…
A: Please follow step 2 for detailed explanation.
Q: Q11: You are comparing the process of RNA splicing in an mRNA from normal and mutant cells of the…
A: Splicing The process by which non coding part of mRNA is removed and coding parts are joined…
Q: Fossil fuels are a sink for carbon located in the a. hydrosphere. b. lithosphere.. c.…
A: Fossil fuels They are the prehistoric dead plant and animal which is made up of hydrogen and…
Q: Do answer both 8. Species A, B, and C are three species of closely-related insects. All three of…
A: Evolution is the slow process of modifying the heritage characteristics of organisms over millions…
Q: write a short dicsussion based on the graph..
A: In order to write the paragraph, it is important to understand what an absorption spectra means.…
Q: 12. Label the following structures on the integument model below Epidermis Dermal Papillae Papillary…
A: The skin comprises several tissues that work together to perform specialized and dedicated tasks.…
Q: ADDITIONAL METRIC SYSTEM PRACTICE 1. Practice using metric length measurements by performing the…
A: Bacteria are prokaryotic simple unicellular and microscopic they may from filament or thread like…
Q: Give a detailed description of the structure, characteristics, and functions of carbohydrates . Then…
A: Introduction Plant foods tend to be high in carbohydrates. As a milk sugar known as lactose, they…
Q: You are conducting an experiment studying sex linked traits. I. The experiment you cross 2 different…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: What clinical and laboratory findings would lead to a diagnosis of liver cirrhosis?
A: Acute or chronic liver damage which can be caused by various liver diseases like hepatitis or due to…
Q: A species of centipede has a haploid chromosome number of 2. Leg length is controlled by a single…
A: Introduction Mendel's law of independent assortment states that the alleles of two (or more)…
Q: How would a changed heritability parameter from 0.5 to 1 affect the time to evolve in a generation?
A: Variations are differences in the genetic composition or phenotypic characteristics of an organism.…
Q: DNA
A:
Q: Which has more hydrogen ions, grapefruit juice (pH = 3) or tomato juice (pH = 4) and how much more…
A: How to calculate H+ ion in the specific pH? The pH of any solution is determined with the help of…
Q: Binomial expansion 1. A couple who are both heterozygous for albinism plan to have eight children.…
A: Heterozygous The condition where both copy of same gene having different alleles.
Q: Pathophysiology) 1. apply acute and chronic inflammation to select clinical models.
A: An initial physiological reaction to tissue injury, such as that brought on by mechanical, thermal,…
Q: (40 OA Diatoms Living or prepared slide Magnification: Toox O O Diatomaceous earth Student…
A: Sand filters are used to filter the impurities present in the pool water. Diatomaceous Earth is a…
Q: Question: 1 Posterior Pituitary Gland: W. Receives information through the hypophyseal portal…
A: The main function of your pituitary gland is to produce and release several hormones that help carry…
Q: Describe kinases and cyclins. How do they interact to cause cellsto move through the cell cycle?
A: Cells must duplicate their DNA before they divide in order to pass an identical copy of their…
Q: Explain the following terms and what are its corresponding requirements for Raman applications: a.…
A: Confocal microscope Cytation C10 confocal imaging reader combines automated confocal and widefield…
Q: How bacteriophage lambda carrying your gene of interest can introduced into the host cells.
A: Introduction : The viruses that infect and reproduce within bacteria are called bacteriophages.…
Q: Explain in detail how two tissues as different as blood and bone both meet the definition of…
A: Introduction: Connective tissue are type of tissues which binds and supports other tissues of…
Q: Which statistical calculation would be used to study the range of variation that is present in a set…
A: Introduction : The study of gathering, analysis, interpretation, presentation and organisation of…
Q: need help
A: Photosynthesis is the process by which green plants prepared their food with the help of Sunlight,…
Q: Od ammonification QUESTION 13 The geothermal gradient is due to a decaying radioactive elements that…
A: Introduction :- The rise in temperature with depth in the Earth's crust is known as the geothermal…
Q: What are the advantages and disadvantages of establishing survey vs a surveillance system.
A: Advantage of survey 1. High Representativeness Surveys provide a high level of general capability in…
Q: How Metastatic tumors arise ?
A: The tumor is the term given to the mass of cells or tissues formed when the cells of that tissue…
Q: Bacteriophage Lambda Describe the procedures you used to retrieve your gene of interest from the…
A: Bioinformatics gives information about the application of the intricacies of biological information.…
Q: 1. The somatic cells of cabbage contain 14 chromosomes. How many are present in each cell at the…
A: The cell division is the cellular process that involves production of two or more than two (four)…
Q: Question 18 Listen It is possible to inherit an allele that arose as a spontaneous mutation a) True…
A: Introduction The mutation is the sudden deleterious effects in the DNA sequences, they can arise…
Q: Feeding behavior of spiders
A: All spiders are carnivorous in habit. Their preys consist chiefly of insects.
Q: How does the slope of a line on a graph indicate rate (such as rate of transpiration)
A: The graph is consists of x-axis that has independent variable, y-axis that has dependent variable…
Q: Calculating surface area and volume in relation to cell size. Calculate surface area, volume,…
A: The surface area of the cell refers to the external area covered by the cell and the volume of the…
Q: What is the genotype of the following? Place the dominant (A) or recessive (a) allele on the "X"…
A: Introduction : In a living organism, passing on various traits from one generation to the next is…
Q: homologous
A: Chromosomes are found in the nucleus of living cell . Which are hereditary materials for living…
Q: Are bacterias classified as projaryotic or eukaryotic?
A: Introduction :- A nuclear membrane is present in eukaryotic cells. It has a cell wall, mitochondria,…
Some silent mutations have been found to be associated with disease. Suggest a possible mechanism for this. How would you test this hypothesis?
Step by step
Solved in 2 steps with 1 images
- The word mutation is generally considered to be negative. However, is there a positive side to mutations? Briefly explain your answer.Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.
- An individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon. Prior to acquiring this mutation,the individual had been exposed to UV light, proflavin, and5-bromouracil. Which of these three agents would be the mostlikely to have caused this somatic mutation? Explain your answer.a. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?Mutations within the genes for ARSs, are known to be cause certain human maladies, such as the neurodegenerative disorder Charcot-Marie-Tooth (CMT) disease along with other central nervous system dysfunctions, and cancer. Interestingly, not all those who possess mutations within specific ARS genes do not display the disease phenotype. Provide at least one reason why a person might survive. Remember, do not just name a concept. Describe the concept and then explain WHY (on a molecular level) this explanation holds true.
- While a stem cell transplant from an unaffected donor is currently the only cure for DBA, genome-editing technologies may one day enable the correction of a mutation in a patient’s own bone marrow stem cells. However, what specific information would be needed, beyond a symptom-based diagnosis of DBA, in order to accomplish this?Cx is a member of the family of connexin genes that encode the proteins of gap junction intercellular channels. Cx proteins in one cell form hemi-channels in the plasma membrane. Hemi-channels in adjacent cells dock to form complete intercellular channels through which ions and small molecules diffuse from cell to cell. Distinct Cx mutations were identified in three different families, F1, F2 and F3, affected by the same disease. To study their functional properties, normal (wild type, wt) and mutant (m) Cx proteins were expressed in cultured cells. Translation of the proteins was checked (Fig. 3). A extracellular EC 1 SM TM 1 membrane 2 3 4 F10 intracellular N F2 EC 2 F3 oricand c B 42 kDa C 42 kDa 35 kDa Control wt m-F1 m-F2 PM C PM C PM C PM C Western blot anti-Cx Control wt PM C m-F1 PM C PM C = Metabolically labelled m-F2 PM C m-F3 PM C m-F3 PM C WSEY Fig. 3 mont (A). Membrane topology of Cx protein indicating positions of mutations. Cx is an integral membrane protein with 4…Some mutations affect changes in protein structure and function that can result in disease whereas other mutations have no significant effects on protein structure and function. Please explain reasons for the above mentioned statement. Human civilization has resulted in a large number of potentially mutagenic chemicals (e.g. pesticides) and has changed the environment to increase the likelihood of encountering other mutagens, especially UV radiation. What roles should the authorities play in identifying mutagens and regulating their release into the environment?
- Can someone give me a few inherited disorders that are NOT caused by mutations? and if possible, please explain/name a gene that contributes to this disorder? Thank you!The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingGene mutations can be classified in two major ways:(1) hereditary or germline mutations that are inherited from a parent and are present throughout a person’s life in virtually every cell in the body.(2) acquired or somatic mutations that occur at some time during a person’s life and are present only in certain cells, not in every cell in the body.If there is no family history of a particular disease but a child has the disease then it may have arisen due to a(n) ________ mutation early during development. A) acquired B) inherited C) silent D) transition