Some Events that May Occur during Transcription 1. RNA polymerases detach. 2. DNA polymerases detach. 3. DNA polymerases proofread. 4. RNA double helix is unzipped. 5. DNA double helix is unzipped. 6. DNA double helix forms again. 7. MRNA is built in the 3' to 5' direction. 8. MRNA is built in the 5' to 3' direction. 9. RNA ligase fuses the Okazaki fragments. 10. RNA polymerase binds to the sense strand. 11. DNA polymerase binds to the sense strand. 12. RNA polymerase binds to the antisense strand. 13. DNA polymerase binds to the antisense strand. Listed in sequence, the events involved in DNA transcription numbered above are

Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…

A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…

Q: 20. Describe three types of DNA repair that can occur in the cell. Name the three types and briefly…

A: Any of numerous ways by which a cell maintains the integrity of its genetic code is known as DNA…

Q: What is the function of the Primase enzyme?     To edit out primers at the end of DNA replication…

A: DNA replication: It is a kind of process in which the DNA makes multiple copies of itself during…

Q: representation of DNA replication. Complete your representation for a single helical turn. 2.…

A: Gene expression is a complex process in which a required protein is synthesized by the instructions…

Q: Step 1: Transcribe and translate the DNA sequence provided. ➤Write the mRNA sequence for the entire…

A: DNA is Deoxyribonucleic acid and RNA is Ribonucleic acid. These two are the genetic materials found…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: Template Strand:The template strand is indeed the DNA strand that serves as a template during…

Q: 1.Make a flow diagram to describe each of the prokaryotic DNA repair mechanism 2. Give 2 examples of…

A: DNA repair is a constant process in the cells where the damage is repaired. The cell contains a…

Q: 1. The RNA nucleotides part of the telomerase structure is used as the for creating the repeated…

A: Telomeres are the repeating nucleotide base sequences present at the terminal part of linear…

Q: 6. This is where the RNA polymerase is bound and a short region of DNA is accessible to begin the…

A: In bacteria,The RNA poltmerase enzyme binds and unwinds promoter DNA and open promoter complex form…

Q: What is the difference between Rho Dependent and Rho Independent termination in prokaryotes?

A: Introduction : Transcription is the process in which RNA is synthesized by taking DNA as a template…

Q: the following mutations silent, missense, nonsense, or frameshift mutations, why? The original…

A: MUTATION:- It is the heritable change in the nucleotide sequence of the genes of an organism.. For…

Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…

A: DNA strand "A" =  5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…

Q: 31. During DNA repair in both prokaryotes and eukaryotes, which of the following enzymes forms a…

A: DNA is a double stranded, helical macromolecule in which the strands are antiparallel. DNA is…

Q: the 3’-OH groups

A: Since you have asked multiple questions , we will solve the first question for you. If you want any…

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: A RNA  is produced by the process of transcription. Unit of transcription is called transcription.…

Q: 18) In what way is RNA polymerase different than DNA polymerase?     RNA polymerase takes part in…

A: Introduction:- Transcription, which produces RNA from DNA, Protein, which gives an organism its…

Q: Which strand of DNA is used by RNA polymerase during transcription? O Coding strand O Lagging strand…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3'-TACT…

A: Wild type sequence:                           3' TACTGACTGACGATC 5' Complementary : 5'…

Q: I need help with a microbiology question from my study guide. The question involves DNA sequencing.…

A: mRNA sequence transcribed from the given template (antisense) is:   3'-A U G A C U G A C U G C U A G…

Q: Transcription is similar to DNA replication in that ... -RNA molecules are synthesized…

A: Transcription is the process by which information encoded in DNA is copied into RNA. It occurs in…

Q: 1. What term is referred to the process of removing large portions of the RNA primary transcript…

A: Introduction :- Splicing is the process of excising introns (noncoding sections of genes) from…

Q: "Builders" Initiation Termination Input/Starting Monomers Product/Final Signal Signals (think…

A: Replication, transcription and translation  all these processes occurs in 3 steps- initiation…

Q: Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs…

A: The process by which a cell makes an RNA copy of a piece of DNA. This RNA copy, called messenger RNA…

Q: 8. Helps RNA polymerase recognize and bind the promoter. 9. Assemble the 30S, 50S ribosome, mRNA and…

A: The production of new DNA from the old DNA is known as replication. The production of RNA from DNA…

Q: A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons…

A: A. In an mRNA exons refer to the coding region while introns refer to the non-coding regions. During…

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…

Q: The operator is the side of the DNA where ---- binds 1. Repressor 2. DNA polymerase 3. Ribosome…

A: INTRODUCTION An operator is a genetic sequence which allows proteins responsible for transcription…

Q: The nucleotide at which transcription is initiated is called 1. -10 2. +1 3. -35 4. 0 5. -1

A: Transcription is the process by which gene are made to mrna sequence.

Q: The accuracy of transcription is less than the accuracy of DNA replication. The error rate of…

A: Replication is the process which is responsible for synthesis of DNA from the parental strand of…

Q: 10.  Why does a cDNA copy of a eukaryotic mRNA gene need to be made in order to determine the…

A: Introduction :- DNA acts as the genetic material of the cell . DNA is made up of two strands , and…

Q: 1. In the Central Dogma, what process involves the production of a new DNA strand using an old DNA…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: What's the role of DNA in protein synthesis? What occurs during transcription and why is it…

A: Central Dogma: It explains the flow of information(genetic) from DNA to RNA that is needed to make a…

Q: Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases…

A: Introduction DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: 6. Use the image to determine what type of mutation is found in each of the DNA strands below and…

A: The provided data showcases different mutations in DNA strands and their corresponding effects on…

Q: 1. (a)  RNA polymerase synthesis in a 5 -3 direction     Gene is switched ON     Gene is switched…

A: RNA synthesis and DNA synthesis both takes place in 5' to 3' direction. But these two synthesis has…

Q: Q1: Why is only one strand of DNA used as a template? Q2: If a mutation occurred within the promoter…

A: Introduction  Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads…

A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…

Prokaryotic evolution

The term evolution means the gradual change or a transformation from a simple or primitive state to a complex or advanced state. Prokaryotic evolution is a concept that involves the evolution of the form and function of most primitive organisms (prokaryotes) through several stages and changes to form diverse life as a part of organic evolution.