Some Events that May Occur during Transcription 1. RNA polymerases detach. 2. DNA polymerases detach. 3. DNA polymerases proofread. 4. RNA double helix is unzipped. 5. DNA double helix is unzipped. 6. DNA double helix forms again. 7. MRNA is built in the 3' to 5' direction. 8. MRNA is built in the 5' to 3' direction. 9. RNA ligase fuses the Okazaki fragments. 10. RNA polymerase binds to the sense strand. 11. DNA polymerase binds to the sense strand. 12. RNA polymerase binds to the antisense strand. 13. DNA polymerase binds to the antisense strand. Listed in sequence, the events involved in DNA transcription numbered above are

Q: RNA polymerase transcribes the following DNA template strand: 5' ACC TTT CCG 3' What is the RNA…

A: Gene is the sequence of nucleotides that encode a particular protein.

Q: ) give 3 differences between replication in prokaryotes and replication in Eukaryotes

A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: This is always the first step in the transcription process: O The two DNA strands are partly…

A: Transcription refers to the production of RNA from DNA. From the gene sequence of DNA, a…

Q: What is the function of the Primase enzyme?     To edit out primers at the end of DNA replication…

A: DNA replication: It is a kind of process in which the DNA makes multiple copies of itself during…

Q: Which of these are a DNA sequence are which are a protein? Column A Column B 1. A gene's promoter a.…

A: RNA polymerase - Enzyme used to convert DNA into mRNA. Introns - non-coding part of the gene. Exon -…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: 1. The image shown in Figure 1 below represents a strand of DNA following replication. The black…

A: DNA repair mechanisms helps to repair many accidental lesions that occurs continuously in DNA.…

Q: 18) In what way is RNA polymerase different than DNA polymerase?     RNA polymerase takes part in…

A: Introduction:- Transcription, which produces RNA from DNA, Protein, which gives an organism its…

Q: Don't use Ai

A: Conclusion:     The correct primer used in amplifying the required region of the DNA is 5' GAATGAC…

Q: The RNA polymerase binds DNA template at the promoter region to initiate transcription initiates…

A: Introduction The Key Enzyme Involved In Transcription Is RNA Polymerase. It Creates A Complementary…

Q: Transcription is similar to DNA replication in that ... -RNA molecules are synthesized…

A: Transcription is the process by which information encoded in DNA is copied into RNA. It occurs in…

Q: "Builders" Initiation Termination Input/Starting Monomers Product/Final Signal Signals (think…

A: Replication, transcription and translation  all these processes occurs in 3 steps- initiation…

Q: The light blue RNA strand is complementary to which DNA strand in this figure? To which DNA strand…

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…

Q: The operator is the side of the DNA where ---- binds 1. Repressor 2. DNA polymerase 3. Ribosome…

A: INTRODUCTION An operator is a genetic sequence which allows proteins responsible for transcription…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG

A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases…

A: Introduction DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: 5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the…

A: Transcription is the synthesis of RNA and translation is the synthesis of proteins. There is a…

Prokaryotic evolution

The term evolution means the gradual change or a transformation from a simple or primitive state to a complex or advanced state. Prokaryotic evolution is a concept that involves the evolution of the form and function of most primitive organisms (prokaryotes) through several stages and changes to form diverse life as a part of organic evolution.