Show Calculations and Formulas. Please calculate the Ksp for uraninite (reaction 1) and rutherfordine (reaction 2).             UO2 + 4 H+ < ---- > U4+ + 2 H2O            (reaction 1)             UO2CO3 < ---- >  UO22+ + CO32-             (reaction 2)

Q: This cytochrome was shown to act as the electron donor to a selenate reductase (Se04²¯ + 2e¯ ⇒…

A: The objective of this question is to determine the final concentration of selenite in the reaction…

Q: None

A: To solve this problem, we will use the concepts of adsorption isotherms, specifically the Langmuir…

Q: In the experiment, what is the resulting color of the FeCl3 solution after Reaction: FeCl3 +…

A: The reaction is as :- FeCl3 + NH4SCN ----&gt; NH4Cl + Fe(SCN)Cl2

Q: At a steady state in the living cell, (ATP) = 10-3M and (ADP) = 10-4 M. The maximum (equilibrium)…

A: First with the value of K, the overall reaction is: Glycerol + ATP ----------&gt; Glycerol…

Q: When 10 g of activated carbon is mixed with 1 M 100 ml of acetic acid solution and filtered, a 20 ml…

A: In such question determine the amount of acetic acid initially and then in filtrate with the help of…

Q: Consider the extraction of UO22+ ions from pregnant solution which contains Pb2+, K+, Na+, and Ca2+…

A: A question based on analytical separation that is to be accomplished.

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

A:

Q: CAg3-CECH O CAgs-c=cAg CH3-c=CAg CHAE2 CECH elect one: а. 4 O b. 3 с. 1 O d. 2

A: The question is based on the concept of organic reactions. we have to react silver with propyne and…

Q: 45.00 0.00 .00 0.00 25.00 20.00 15.00 10.00 5.00 0.00 o.bo 200 4.00 00 1000 1200 14.00 Mes Which…

A:

Q: The isoelectric point, pI, of the protein trypsin is 10.5, while that of horse liver alcohol…

A: The isoelectric point of amino acid is the pH at which the net electronic charge of the amino acid…

Q: Calculate the value of E°cell for the following reaction: 2Au(s) + 3Ca²*(aq) ® 2Au³+(aq) + 3Ca(s)…

A: Cell reaction :-  2Au(s) + 3Ca2+(aq) --&gt; 2Au3+(aq) + 3Ca(s)  Reduction potential :-  Au3+/Au  E°…

Q: Ali has measured the oxidative stability of palm oil sample under accelerated storage condition at…

A: Sample weight 1.0030 g Concentration of Na2S2O3 = 0.001 N Volume of Na2S2O3 titrated for sample…

Q: A research group discovers a new version of the rainbowase enzyme, which they call rainbowase*, that…

A: “Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: 46. The Tl in a 7.51-g sample of rodenticide was oxidized to the trivalent state and treated with an…

A: Since you have posted multiple questions I will answer the first question for you. For the rest to…

Q: Two samples of polystyrene, samples A and B, were synthesised. A from the addition of n- butyl…

A: Introduction: Polymers: Polymers are the large molecules made up of repeating units. The physical…

Q: Based on the chemical reactions provided, which of the following is equivalent to KCa-EDTA? a.…

A: Equilibrium constant, K :-  The ratio of product of equilibrium concentrations of Products to…

Q: The isoelectric point, pI, of the protein nitrate reductase is 4.2, while that of beta-glucuronidase…

A: Answer. Isoelectric point for any compound is the point at which the net charge on the compound is…

Q: When the Cu²+ concentration is 1.20 M, the observed cell potential at 298 K for an electrochemical…

A: From data,  Standard Reduction potential of Cu2+/Cu = 0.337V  Standard Reduction potential of…

Q: Question 28 4) Listen Balance the equation As₂O3(a) + Ca(OH)₂(aq) - Cay(AsO4)2(a) + H₂O(l)

A: We have to balance the given Reaction.

Q: What would happen if 1.00 mmole of lactic acid (pKa 3.86) was added to a sample containing 6.50…

A: The pH of conjugate acid base pair or acidic buffer is calculated using following equation;

Q: i Look up and list the size of the following proteins; then predict in what order they would be…

A: Soln Compounds elute in order of decreasing size in Gel Filtration Chromatography. This is due to…

Q: 7. Find the AHrxn for the reaction: 3C(s) + 4H₂(g) → C3H8(g) Use these reactions with known AH's:…

A: Hess's law states that the heat of the reaction is fixed and it is independent of the path of the…

Q: Isoleucine has pką values of 2.32 (-COOH) and 9.76 (-NH3*). At which pH would isoleucine migrate…

A: The isoelectronic point or isoionic point is the pH at which the amino acid does not migrate in an…

Q: 20.Which answer represents the correct balancing coefficients (in order from left to right) & the…

A: Balancing a reaction.

Q: According to the table below, Zn- has a slightly larger mobility than Na" How can you explain that?

A: Ionic mobility: It is defined as the speed gained by ions moving through gas under a unit electric…

Q: 4. THE EFFECT OF PH Tube # 1 2 3 4 5 6 7 18 pH 17 7 8 8 9 9 10 10 Abs. N/A 0.07 N/A 0.84 N/A 0.76…

A: The objective is to determine the effect of pH.

Q: Design a cell that will enable you to measure the Ksp of PbCl2

A:

Q: At a pH of 10 what is the fraction of EDTA that is in the form Y4-? I got 0.30 but I believe that is…

A: The fraction of EDTA in the form of Y4- is equal to the αY4- value at that pH.

Q: The thiourea in a 1.408-g sample of organic material was extracted into a dilute H2SO4 solution and…

A:

Q: The potassium dichromate (K2Cr207, Mw = 294.2 g/mole) contained in a 1.3 g of impure sample was…

A: Limiting reagent is the reactant molecule that decides the amount of product molecules formed as it…

Q: Calculate the Ksp for uraninite (reaction 1) and rutherfordine (reaction 2).             UO2 + 4 H+…

A: Solubility balance is a kind of complex balance that occurs when a solid chemicals compound is…

Q: `Me (Ph3P)2PdCl2 Me. Cul, iPr2NEt

A:

Q: d) Calculate the equilibrium constant for the reaction between Ferredoxin and plastocyanin under…

A: The reduction potential values to be used are: Ferredoxin(Ox) + e-  ----&gt; Ferredoxin(Red) ; Eo =…

Q: n/takeAssignment/takeCovalent Activity.do?locator-assignment-take [Review Topics] [References] Use…

A: The reaction will be --&gt;  ZnI2 (s) + H2O (l) --&gt; Zn2+ (aq) + 2I- (aq)

Q: 3.Use the following atomic masses (in g/mol): Ca = 40.08; C = 12.01; O = 16; Na = 23; Cl = 35.45 3.)…

A:

Q: What could be some sources of error (at least 3) when determining the ksp of AgCrO4

A:

Q: 13. You were provided with a trypsin stock solution of known enzymatic concentration of 0.75 ug/ml.…

A: Trypsin is a protease enzyme. It helps in biochemical reactions in the body. Its medication is…

Q: A 0.1017-g sample of KBrO3 (MW = 167 g/mole) was dissolved in dilute HCl and treated with an…

A: In iodometry iodide ion(I-) reacts with oxidising agent and forms iodine which reacts with sodium…

Q: We chemically linked three reactions together. Which one(s) were fast relative to the other(s)? Why…

A: The given 3 equations represent all the chemical reactions taking place during an iodine clock…

Q: Rank the migration rate of the following amino acids in ascending order towards  the cathode when…

A: PI stands for isoelectric point. If pH is less than isoelectric point then amino acid will move…

Q: Consider the Ksp values of the following ionic compounds at 25 °C 2+ Ba² Pb²+ 2- CrO₂² 1.2 × 10-¹0…

A: The question is based on the concept of solubility product principle.It states that when a weak…

Spectroanalytical Methods

Spectroanalytical methods measure the wavelength and intensity of radiations that are either emitted or absorbed by a molecular or atomic species. These methods are useful for evaluating the electronic or atomic arrangement of the molecules of a given analyte.