Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in Figure 15.11 was mutated from G to U. Give all codons with which the new, mutated anticodon could pair. SerSerTRNA1 Pairing at the thirdcodon positionis relaxed.Anticodon.Wobble3'AGG 5'UCC3'AGG S' positionUCU 3'5'Codon2 G in the anticodoncan pair with C...3...or with U.15.11 Wobble may exist in the pairing of a codon and anticodon.

Name: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in Figure 15.11 was mutated from G to U. Give all codons with which the new, mutated anticodon could pair. SerSerTRNA1 Pairing at the thirdcodon positionis

The 61 codons codes code for 20 different amino acids. So, there must be 61 different tRNA…

Science

Biology

Ser Ser TRNA 1 Pairing at the third codon position is relaxed. Anticodon. Wobble 3'AGG 5' UCC 3'AGG S' position UCU 3' 5' Codon 2 G in the anticodon can pair with C... 3...or with U. 15.11 Wobble may exist in the pairing of a codon and anticodon.

Ser Ser TRNA 1 Pairing at the third codon position is relaxed. Anticodon. Wobble 3'AGG 5' UCC 3'AGG S' position UCU 3' 5' Codon 2 G in the anticodon can pair with C... 3...or with U. 15.11 Wobble may exist in the pairing of a codon and anticodon.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 6P

See similar textbooks

Similar questions

4
13c give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with including wobble matches
A tRNA anticodon is 5ʹ GCU 3ʹ. What codon can it bind to and what amino acid should it carry? There are more than 1 answers. 5' AGA 3' arg 5' AGU 3' ser 5' CGA 3' arg (was not the answer) 5' UCC 3' ser 5' AGC 3' ser
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCC
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above)
Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
helpp, if u could do this one first please
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′
Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?