Scientists have estimated that there may be as many as . . or more different humanproteins, all coded by . .protein-coding genesO 1: 500,000 & II 20,000O 1: 20,000 & II: 500,000O 1: 30,000 & II: 50,000O 1: 50,000 & II: 30,000

Genes are segments of DNA that are involved in controlling a trait expressed by the cell. Protein…

Answered: Scientists have estimated that there…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

this is what i have said about this image so far, what else can be said aswell including the raw count column. " Interpreting the results of an RNA-Seq analysis is pivotal in understanding the underlying genetic mechanisms of diseases such as breast cancer. In this analysis, Figure 1 provides comprehensive data on differentially expressed genes associated with breast cancer. By delving into the provided information, we can gain valuable insights into the molecular landscape of this disease. First focus is on the gene with the highest fold change, EYA4, situated on chromosome 6. With a staggering fold change of 3604.4176, EYA4 exhibits an unprecedented level of overexpression in cancerous cells compared to normal cells. This profound alteration suggests a pivotal role for EYA4 in breast cancer pathogenesis. The log2 fold change of 11.81555 further emphasizes the magnitude of this difference in gene expression. Statistical significance is evident, with an exceptionally low p-value of…
Please draw a diagram to show the genomic organization of a gene with three exons
The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns. The diagram below (not drawn to scale) represents the map of the SURF1 gene. Allele #3 Change from AGGT to ACCC at 1 15, 914 exon/intron border E1 E2 ЕЗ E4 E5 E6 EŽ E8 E9 E10 EA1 ATG start codon Allele #4 TAA stop codon Allele #2 insertion of T deletion of 27 bases Consider the following mutation, Allele #4 in a cell, which of the following are possible for the processed mRNA & protein product from this mutant allele? Select all that apply The processed mRNA expressed from this mutant allele may be longer than that from the wild-type allele The processed MRNA expressed from this mutant allele may be shorter than that from the wild-type allele The protein expressed from this mutant allele may be shorter than that from the wild-type allele O The protein expressed from this mutant allele may be longer than that from the wild-type allele
Y-STR and mtDNA tests have less impressive statistical weights than autosomal tests because..... They undergo a mutation rate that is at least ten times greater than that of nuclear genes There are thousands of copies of each in every cell and their information is redundant They both contain a relatively small number of genes and all are under strong selective constraint They are both involved in cytoplasmic inheritance and approximately 10% of individuals have been found to be chimeras They are paternally and maternally inherited, respectfully, and there is therefor no opportunity for recombination to occur
Which of the following pairs is mismatched? None of the pairs are mismatched Joseph Lister – Discovered the antibiotic penicillin Edward Jenner – developed the first smallpox vaccine using cowpox virus (vaccinia) Barbara McClintock – discovered transposons through her research with corn genetics
Let’s say, you want to deliver a gene into a cell and in your lab, there are lot of options available to do that. Describe five different options that you can use to deliver that gene.
Sarah has always lived what many consider an active and healthy lifestyle. She makes a conscious effort to eat well and exercise daily, never smoked, and drinks moderately. Many of Sarah's female relatives (including her mother and grandmother) have had breast cancer. Sarah has decided to have her genome sequenced. She is specifically interested in whether she shows mutations in BRCA1 and BRCA2 that are linked to breast cancer. What information can be drawn from the sequence data Sarah will receive? Justify your answer. • Sarah will know if she will develop breast cancer. • Sarah will know if and when she will develop breast cancer. • Sarah will know the severity of her breast cancer based on the number of mutations; that is, the more mutations in those genes, the greater the severity of the disease. • Sarah will know whether she is predisposed to breast cancer. • Sarah will know that she will not develop breast cancer if there are no mutations in those genes.
Alzheimer’s is a progressive neurological disorder resulting in dementia and memory loss that occurs in 10% of the US population older than 65. In the 1990s, several researchers showed evidence that the allele of a cholesterol precursor gene, APO E4, increased risk of developing the disorder compared to APO E2 or APO E3. This was especially pronounced if patients carried two alleles of APO E4. However, not all people with APO E4 develop the disorder and some without it will present with Alzheimer's nevertheless. This suggests other genes influence development of the disease. Current research has elucidated dozens of genes that interact with APO E4 pathways in hundreds of ways. As many as 27 of the interactions are epistatic, with some as dominant epistasis and some as recessive epistasis. In addition, some of the gene candidates for non-APO E4 Alzheimer’s have other relationships such as dominant, codominant or incomplete dominant. No reliable cure currently exists for Alzheimer’s…
Match the numbered concepts to the lettered facts. Explain why each pair is the best match. (1) Gene Duplication (2) Molecular Clock (3) Pseudogene (4) SINES and LINES a. Different kinds of globin chains arose over time including myoglobin, alpha globin, beta globin 1, delta globin, and beta globin 2.b. The two human beta globin genes, 1 and 2, differ at 20 base pair sites; only beta gene 1 produces a functional protein.c. In human hemoglobin, the delta polypeptide chain differs by 39 amino acid sites vs. the beta chain.d. The human alpha globin gene and the mouse alpha globin gene are orthologous to each other.
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS

Scientists have estimated that there may be as many as . . or more different human proteins, all coded by . .rotein-coding genes O 1: 500,000 & II 20,000 O 1: 20,000 & II: 500,000 O 1: 30,000 & II: 50,000 O 1: 50,000 & II: 30,000