If an individual is heterozygote for the patterns in a and b, which fragment(s) wouldappear on the gel? Restriction mapping of a linear piece of DNA reveals the following EcoRI restrictionsites.EcoRI site 1ECORI site 22 kb4 kb5 kb

Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…

Answered: Restriction mapping of a linear piece…

Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI site 1 ECORI site 2 2 kb 4 kb 5 kb

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’

See similar textbooks

Related questions

Q: HindIIIrecognizes the sequence AAGCTT and cleaves between the two A's. What type of end is produced…

Q: In the sample data from Sordaria shown in the picture: Count the total number of first and second…

A: the total number of crossing over and the total number of non-crossing over indicates the total…

Q: P1 P2 A B C D EE GH 4 (a) Identify which pairs of numbered bands correspond to the two segregating…

A: IntroductionA gene is the basic unit of heredity. A gene exists in two alternative forms called…

Q: chromosome of genotype C D recombines with a homolog of genotype c d during meiosis when Spo11…

A: * Given that chromosome of genotype "CD" recombines with a homologous of genotype "cd" during…

Q: P. D, and Q are three genes found on a single chromosome in greyhounds. The recombination…

A: The genetic map is defined as the arrangements of genes according to the recombination frequencies…

Q: The a, b, and c loci are all on different chromosomesin yeast. When a b+ yeast were crossed to a+ b…

A: Step: 1 Yeast is a member of the phylum Ascomycota of the kingdom fungi. These are commonly known as…

Q: A double heterozygote has the repulsion configuration Ab/aB of two linked genes that have a…

A: It is given that a double heterozygote has the repulsion configuration Ab/aB of two linked genes…

Q: From the fungal cross arg-6 ⋅ al-2 × arg-6+ ⋅ al-2+, whatwill the spore genotypes be in unordered…

A: Introduction: Inheritance is a term used to describe the process by which a parent's traits are…

Q: Recombination frequencies between four genetically-linked loci in corn are shown in the following…

A: Recombination frequency is a measure of genetic linkage and is used in the creation of a genetic…

Q: In Neurospora, the mutant stp exhibits erratic stop-andstart growth. The mutant site is known to be…

A: mtDNA stands for mitochondrial DNA. If an stp strain is used as the female parent in a cross with a…

Q: The DNA of every individual in the pedigree shown in image B (below) has been sequenced at the…

A: A pedigree chart is a visual tool used in genetics to show the pattern of inheritance of a trait or…

Q: Recombination frequencies between three loci in corn are shown in the following table: Loci…

A: Recombination frequency is the frequency with which a single chromosomal crossover will take place…

Q: Based on the data in Table 1, which individual(s) is/are heterozygous? Select all that apply a) B…

A: Heterozygous implies that different variations of a certain quality from each parent have been…

Q: 6.4 Write genotypes correctly to indicate if two genes are linked or not and if linked, the…

A: A gene is a basic unit of heredity and a sequence of nucleotides in DNA that basically encodes the…

Q: Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent…

A: Wildtype Chromosome: The reference wildtype chromosome is given as "ABCDE-FGHIJK" with the numbers…

Q: Assume that curly hair (C) is dominant to straight hair. Albinism (P ) is recessive to normal skin…

A: Dominant trait can express itself if present in homozygous as well as heterozygous condition whereas…

Q: Two strains of S. cerevisae (yeast) are crossed. One has the genotype A B and the other a b.…

A: Crossing over a phenomenon that occurs in the cell by exchanging the genetic material between two…

Q: Calculate the recombination frequency between the Trf and the d loci by using the pooled data from…

A: The transferrin gene and the dilution locus are located on the same chromosome. The transferrin gene…

Q: Why is a human Rab protein with no direct yeast equivalent chosen as an “outgroup” for a study?

A: Rab proteins →Ras-associated binding proteins are part of the Ras superfamily that are involved in…

Q: In Figure 3-11, if the input genotypes were a • B and A • b,what would be the genotypes colored…

A: Genetics is a branch of biology involved in the study of genes, genetic variation, and heredity in…

Q: * * * COMME * **0000 * ** ****** 6000*** 2008 000000 * * *

A: Tetrad analysis is a genetic method utilized in yeast, Saccharomyces cerevisiae, to explore the…

Q: A pair of paralogous repeats, A and B, have 96% sequence similarity and therefore can promote…

A: There are a few important points about genetic recombination. Recombination is a large-scale…

Q: The white spots in this image represent Barr Bodies. The cells are from a Male cell line. What is…

A: In the provided scenario, we are examining a male cell line where white spots represent Barr Bodies.…

Question

100%

If an individual is heterozygote for the patterns in a and b, which fragment(s) would
appear on the gel?

Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction
sites.
EcoRI site 1
ECORI site 2
2 kb
4 kb
5 kb

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 ori
A = double cutter (1000 bp, 800 bp) - 800 is being cut by the single cutter because 600 + 200 = 800, 1000 is intact B = single cutter (2000 bp) A/B (1000 bp, 600 bp, 200 bp) Using the plasmid map identify which enzyme is the single and double cutter
Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
Below is a plasmid with restriction sites for Baml and EcoRI, Several restriction digests were done using these two enzymes either alone or in combination. Hint: Begin by determining the number and size of the fragments produced with each enzyme. "kb" stands for kilobases, or thousands of base pairs. Plasmid Gel lanes I | III IV V 6 Kb Bam HI Bam HI. 20 Kb PGEN101 (20 Kb) 2 Kb 11 Kb Bam HI 8 Kb 8 Kb 4 Kb 6 Kb Eco RI 3 Kb 21. Which lane shows a digest with BamHl only? a. I b.I c. II d. IV e. V 22. Which lane shows a digest with EcoRLonly? a. I 23. Which lane shows the fragments produced when the plasmid was incubated with both EcoRI and BamH1? a. I b.I c. II d. IV e. V b. I c. II d. IV e. V Base pairs
Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA, tRNA, and protein using the figure that will post here
The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the reaction of TaqI with the DNA sequence shown.
DNA Polymerase Holoenzyme Ill is represented below. It consists of several domains with distinct functions. The structure that provides high processivity (processivity factor) is represented by the letter and the structure that provides DNA proofreading function is represented by the letter A В. -C -D DNA Pol III holoenzyme В; D А; А А; D D; A A; C
How many fragments and how big each fragment should be after digesting the plasmid with BamHI? How many fragments and how big each fragment should be after digesting the plasmid with PvuI? How many fragments and how big each fragment should be after digesting with both enzymes? Show your calculation/explanation.
Clone number in this case is number 196 which is shown in the images. State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the human DNA with the plasmid vector band sizes are shown in one of the images. (0.5, 1, 2, 3, 4, 5, 6, 8, 10kb)
The DNA sequence below is used by the primase to synthesize a primer. What is the sequence of the primer? 5’-ACGTGCT-3’
Enzymes of bacterial origin used in a wide variety of techniques are: ligases restriction endonucleases primase dna polymerase resctriction exonuclease