Respiratory Post Workshop Math To answer the following questions, it is recommended that you begin by drawing a general Volume and Capacity graph (Volume vs Time), and label all.of the different types of values. You should use this graph to help determine how to construct the appropriate equations. You should also show your math because the answers are as follows: (#1: 1.3L, #2: 0.8L, #3: 2.4 L, #4: 3.2L) 1. What is the RV if IC = 3.6L, FRC = 2.4L, VC = 4.7L? Example: Step 1: write out what I am given_and use the graph to break down the capacities into their components. (Do the TLC too.) • IC = TV + IRV • FRC = ERV + RV • vC = IRV + TV + ERV or IC + ERV or IC + (FRC - RV) • TLC = IRV + TV + ERV + RV or lIC + FRC, etc. Step 2: Figure out how to isolate the RV by using the equations. • Notice that I can calculate the TLC by adding the IC + FRC = 3.6L + 2.4L = 6.0L. • The RV can be isolated by subtracting the VC from the TLC: • TLC - VC = RV → 6.0L - 4.7L = 1.3L 2. What is the ERV if IRV = 3.1L, TV = 0.6L, VC = 4.5L? 3. What is the FRC if TLC = 5.7L, VC = 4.5L, ERV = 1.2L? 4. What is the IRV if TLC = 5.9L, TV = 0.45L, RV = 1.0L, EC = 1.7L (NOTE** TV + ERV = EC (expiratory capacity))?

Respiratory Post Workshop Math To answer the following questions, it is recommended that you begin by drawing a general Volume and Capacity graph (Volume vs Time), and label all.of the different types of values. You should use this graph to help determine how to construct the appropriate equations. You should also show your math because the answers are as follows: (#1: 1.3L, #2: 0.8L, #3: 2.4 L, #4: 3.2L) 1. What is the RV if IC = 3.6L, FRC = 2.4L, VC = 4.7L? Example: Step 1: write out what I am given_and use the graph to break down the capacities into their components. (Do the TLC too.) • IC = TV + IRV • FRC = ERV + RV • vC = IRV + TV + ERV or IC + ERV or IC + (FRC - RV) • TLC = IRV + TV + ERV + RV or lIC + FRC, etc. Step 2: Figure out how to isolate the RV by using the equations. • Notice that I can calculate the TLC by adding the IC + FRC = 3.6L + 2.4L = 6.0L. • The RV can be isolated by subtracting the VC from the TLC: • TLC - VC = RV → 6.0L - 4.7L = 1.3L 2. What is the ERV if IRV = 3.1L, TV = 0.6L, VC = 4.5L? 3. What is the FRC if TLC = 5.7L, VC = 4.5L, ERV = 1.2L? 4. What is the IRV if TLC = 5.9L, TV = 0.45L, RV = 1.0L, EC = 1.7L (NOTE** TV + ERV = EC (expiratory capacity))?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Concentrations and volumes are NOT the same thing. Concentrations are in units of mass/volume (i.e., g/l or mg/ml). Volumes are in units of only volume (i.e., 1. ml). 4. a. If you mixed 265 g of sugar with water to get a final volume of 725 ml. what is the concentration of this solution in g/l? Show your work. If you took 1 ml of this solution, what would the concentration be? Explain your reasoning. you prepare a stock solution (highly concentrated) of sugar in water whose concentration is 500 g/l. you need to make a new solution that is half (1/2) as concentrated and has a final volume of 100 ml. Describe how you would make this dilution. Step one: Your new solution has a concentration of_. Step two: To make 100 ml of this new solution, you will need to add_of concentrated stock solution plus_of water. Now make a second solution that is one-tenth (1/10) as concentrated as the initial stock solution and has a final volume of 100 ml. Describe how you would make this dilution.…
help me calculate for the weight based req: weight 125Lbs or 56.7kgHeight 5.5 inches if needed Solve this quickly...strictly needed handwritten only...use the attach information...give u many upvotes needed urgently
Please step by step answer please
The experiment is about testing the ideal gas law (magnesium ribbon experiment)
The kinetic data in the following table were obtained for the reaction of carbon dioxide and water to produce bicarbonate and hydrogen ion catalyzed by carbonic anhydrase. H2O + CO2--> HCO3 + H+ Carbon Dioxide Concentration (mmol L-') 1.25 2.5 5.0 20.0 1/Velocity (M'sec) 36 x 10³ 20 x 10³ 12 x 10³ 6 x 10³ [H. DeVoe and G. B. Kistiakowsky, J. Am. Chem. Soc. 1961 83 (2), 274-280.] Use Excel (or similar) to generate a Line Weaver-Burke plot, then use the equation for a linear-fitted trend line to calculate the substrate affinity of CO2 for carbonic anhydrase. Answer in units of mM. Enter numerical values only, no letters or symbols. Round answer to 2 significant figures.
5
stock aliquot - 1mg/ml use the sequence below to determine the molarity using expasy prot program atgggcgaggagtataaagttgtcctcacatttggatccccaatgagccctaatgcaaataacaaacagacttgggttaataaacctcttgatgcgccttcgggccattacaatgtgaaaattgcaaaggatgttgaccactatctaaccatgcagggtttcacttctatagcatctgttgactggtacactatagattttcaaccatctgaggcgcctgccccgataaaaggcttgcaggtacttgtgaacatctcgaaaaaagctgatgtgtatgccgtcaaacaatttgtcacagcgcagaccaacaacaagcaccaggttacaagcctgttcctagtaaaagtaacaactggttttcaggtgaacaactacctgagttacttttacagggcgtctgctactggggatgccacaactaacctgttggttagaggagacacatacacagcagggataagttttacccagggtggatggtatttgttgacaaatacatctattgttgatggggctatgccacctggctgggtctggaataacgtggaacttaaaactaacacagcgtatcacatggacaaaggcttggtccatctaataatgcctttgcctgagtccacgcaaatgtgttatgagatgctgacatctattccagcggccgcagagctcgctctggtgccacgcggtagttccgctcatcaccaccatcatcaccatcaccaccact
( Please type answer note write by hend )
During transfer of liquids using a micropipette: What would it mean if the mean is very close to the expected value but your standard deviation is high ?
What is the expected condition for a patient with following ABG values of pH 7.5, pco2-46mmHg, HCO--30 m Eq/dL and k+-3.4 mEq/dL Metabolic alkolosis Metabolic acidosis Respiratory alkolosis Respiratory acidosis
Surface Area Cube Side Length Volume / cm3 S.A.:Vol Ratio / cm? 24 cm? ww 8 cm3 3:1 A 2 3375 cm3 1350 cm? 0.4:1 В 15 0.125 cm3 1.5 cm? 12:1 0.5 7.5 421.875 cm3 337.5 cm? 0.8:1 125 cm3 150 cm? 1.2:1
Subject: chemistry