Give a clear handwritten answer with explanation needed 2Quion Some Statement about = DNAin which who is thenot not buve about the 2 DNAstructure ? Explain(1)the helix is left handed(ii) There are 12 base pairs perhelical turn(111) The helical pitch is the similarto that of BDNA() The major groove isconsidered flat(v) The minar groove isconsidered marrow and deep

DNA (deoxyribonucleic acid) is a type of nucleic acid, in which the pentose sugar is deoxyribose.…

Quion Some Statement about 2 DNA in which who is the not not buve about the 2 DNA structure ? Explain (ů) ghe helix is left handed (ii) There are 12 base pairs per helical turn (1) The helical pitch is the similar to that of BDNA () The major groove is considered flat (1) The minor groove is considered marrow and deep

Quion Some Statement about 2 DNA in which who is the not not buve about the 2 DNA structure ? Explain (ů) ghe helix is left handed (ii) There are 12 base pairs per helical turn (1) The helical pitch is the similar to that of BDNA () The major groove is considered flat (1) The minor groove is considered marrow and deep

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter31: Animal Tissues And Organ Systems

Section: Chapter Questions

Problem 1CT: IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may...

See similar textbooks

Similar questions

Natte को irvicle ie wnd te the following DNA Olympics eralls a od come odents, at wy h wy ed ip the ar (warm up) y and anawers e Period a Name Caitlin Myers be writtenin usion sentena DIRECTIONS: Complete each of the following "events" in their proper order. In the first event, you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN'. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). our. thin 1. ATGCATGCGCGACTGG G G TC GGAGTGG 5TACaTACacaCTQACC CCAQCETCACC 31 MRAA -7 AUG CA aca ca4 Eug pca atq yeg sletion Yeu. eiy Ser. HiS. Protein AGI TTC 2. ATGGTACAGAA A A -ACCAT AAGITIIS MRNA- 3. ATGTGTCCAGGTACGTCGTAAGAGATC rotcin is actually a very long molecule composed of many hundreds or thousa Idod on itself many times to create a…
On further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.
Pues (two-ringed) 9. (a) Label each nitrogenous base in the double strand of DNA in Figure 4. NEL P-C.₂. H- (a) -CH₂-P-C₂ 5' 0 PCH₂ (b) -Н -CH₂-P-C₂ 5' 0 PCH₂ CH₂-P-C₂ H 0 I' P 5' 0 (d) 3' CH₂ H PCH₂ Figure 4 (b) Figure 4 above shows a phosphodiester bond. Explain what this is. 1.5 Pr
The two strands for the helix-shaped DNA molecule are heldtogether by electrostatic forces as shown in class. Due to electron sharing, themagnitude of the net average charge on the H and N atoms, each, is 0.2e. Thenet average charge on the C and O atoms, each, is 0.4e. The distance betweenany two adjacent atoms on the same molecule is 0.1nm. Since electric fieldsdecrease as an inverse square law, they die off quickly with distance. So, theonly fields that really contribute to any given bond are due to the 3 atomsalong the red dotted line in the class diagram (two atoms on one'molecule andone atom on the other molecule).Calculate the electric fields and net force between a thymineand an adenine pair.=Calculate the electric fields and net force between a cytosineand a guanine pair.nConsider the OHN bond in the AT nucleotide. Can theelectric field be zero anywhere along the axis of this bond? If not,explain why not. If so, find where the electric field is zero.
smolA eno DNA -- THE DOUBLE HELIX (modified from The Biology Corner - Worksheets and Lessons) The nucleus is a small spherical, dense body in a cell. It is called the "control center" because it controls all the activities of the cell. Chromosomes, found in the nucleus, are microscopic, threadlike strands composed of the chemical DNA (short for deoxyribonucleic acid). Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein which in turn codes for a trait. It is commonly referred to as the gene for baldness or the gene for blue eyes. In 1953, James Watson and Francis Crick established the structure of DNA. The shape of DNA is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all the phosphates red (labeled with a "p"). Color all the deoxyriboses blue (labeled with a "D"). The rungs of the ladder are pairs of 4 types of nitrogen bases. The…
eCt Would mutation M2 have on the protein produced? 4. A protein is found with the sequence Met-Thr-Im-Phe-Lys-Cys-Arg-His-Pro-Gly, A mutant is found with the sequence Met-Thr-Trp-Rhe-Lys. Assuming that the mutant resulted from a single base change in the DNA encoding the gene, what mutation took place at the DNA level and how did that affect the MRNA and protein sequence? Investigate
JILLule should [1] De Tepicated exactly. Figure 2 represents part of a DNA molecule. 5'TT ATGC TT 3' T. C CA G tal: 5] TACG A A G 3' GTC her 5' Figure 2 (c) Show, by means of annotated diagrams, how this piece of DNA is replicated. Distinguish clearly between the original and new strands.
on 94 Which of the following statements is true about DNA? et red Select one: d out of O a. DNA transmit the genetic information thus, DNA must be replicated after each cell division directly question O b. Nucleic acid is another term used to describe DNA only that function to store information O c. The two strands of DNA are antiparallel, and the backbone of DNA is connected through phosphodiester bond in 3' to 5' direction d. DNA directs its own replication, programmed for RNA transcription and involved directly in protein synthesis. O e. Consist of two stands of polynucleotides and the sugar of its nucleotides made from a pentose sugar that lack Oxygen in carbon #2
. The human genome contains about 3 billion basepairs. During the first cell division after fertilizationof a human embryo, S phase is approximately threehours long. Assuming an average DNA polymeraserate of 50 nucleotides/second over the entire S phase,what is the minimum number of origins of replicationyou would expect to find in the human genome?
Which of (a)-(d) is complementary to the DNA segment 5'-ATGAGCCAT-3'? * 5-ТАСТССGTА-3' 5-ТАСТСGGTА-3' 5'-TCATCGGTA-3' 5'-TACTGCGTA-3'
IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer