Answered: Question 24 Listen A unicorn has 11…

Question 24 Listen A unicorn has 11 pairs of chromosomes. How many sister chromatids will it have at metaphase of mitosis a) 11 b) 44 ○ c) 2 d) 22

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Question Select your answer. What is chromatin composed of? DNA + Protein DNA + Carbohydrate RNA +…

A: In nucleus, DNA is not present in a completely free linear form. This is because nucleus cannot…

Q: Question 7 What experiment could you perform to test if KDEL is necessary for protein retention in…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Question: Some states are setting up archives of DNA profiles for all convicted criminals. Should…

A: A investigative method used to identify people based on their DNA is called DNA profiling, also…

Q: "Consider the arrangement of the following four normal chromosomes from some hypothetical organ…

A: Mutation is defined as any change in the DNA sequence of any organism. It can result due to error in…

Q: This next question is good practice to be familiar with thinking about what happens to chromosomes…

A: The replication is the process by which new DNA is synthesized from the old DNA molecule by…

Q: Genetic question

A: Formulas for three point test cross - A. Distance between two genes = (#progenies obtained by SCO…

Q: QUESTION 31 Written from 5' to 3', the sequence of an RNA molecule made using the top strand of DNA…

A: INTRODUCTION Transcription is the process of making an RNA copy of a gene sequence. This copy,…

Q: Question 13 Which regions (s) of the DNA are found in the final protein? Introns Exons UTRS poly-A…

A: Protein: Large biomolecules and macromolecules known as proteins are made up of one or more extended…

Q: Review translation. Which step is not a part of elongation cy O binding of small ribosomal unit to…

A: Translation : It is the process which involves formation of proteins from mRNA and ribosomes . This…

Q: QUESTION 21 You sequence the XRAY gene with Sanger sequencing. A portion of the sequencing gel is…

A: The Sanger sequencing is used to determine the sequence of fragment of DNA. The gel electrophoresis…

Q: Among the following, which one is trans-acting transcription element? Enhancer Silencer…

A: Trans acting transcription element : These are also known as transcription factors , which either…

Q: 17 Which of the following is the reason that 5' exons are usually spliced to exons that are nearby…

A: Exons: An exon is a segment of DNA that codes for a specific sequence of amino acids in a protein.…

Q: Question 14 A ten-fold increase in the concentration of sodium ions increases the Tm temperature of…

A: DNA (deoxyribonucleic acid) is the genetic material in most of the cells. It is a double stranded…

Q: trivia about down syndrome. Give me 10. how the down syndrome occurs?

A: A genetic disorder is a hereditary condition that occurs due to abnormalities in the genome. Genetic…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…

A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…

Q: Which statement on the migration of DNA fragments through agarose gels is false A) Small fragments…

A: Agarose gel electrophoresis is one the technique used in Recombinant DNA Technology and Molecular…

Q: Scenario 2: Examine the following DNA strand. The coding strand is on top and the template strand…

A: DNA is a template for making proteins that are essential for cellular functions. The process of…

Q: Genetics Question 9

A: The objective of the question is to determine whether a mutation in an enhancer that prevents the…

Q: Question 2 "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…

A: Muttation is a phenomenon that occurs due to the alternation in the nitrogenous base pairs in the…

Q: Question 6 What is the complementary DNA sequence of this sequence of DNA: 5'-GTTCCCATG-3'? O…

A: Introduction:- DNA ( Deoxy-ribonucleic acid) is a polymer of deoxy-ribonucleotide units, they are of…

Q: Can substitute bases in DNA because of structural similarity.

A: A mutagen is a physical or chemical agent that permanently alters genetic material, usually DNA, in…

Q: Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a person…

A: Sickle cell anemia is a genetic disorder. It is condition when the normal red blood cells change its…

Q: Question 4: Imagine that you isolated X-receptor proteins from mutant cells with the nonsense…

A: Nonsense mutation is a mutation which occur when a working codon is transformed into one of the…

Q: Question 23 Sickle Cell Anemia Sickle cell anemia is a group of blood disorders that develop when a…

A: A series of genetic diseases collectively referred to as sickle cell disease includes sickle cell…

Q: tely the same amount of DNA? und: You have learned that DNA is n chromosomes. All mammals are…

A: Haploid number means that one set of chromosomes is present where the chromosomes are unpaired.…

Q: True OR False. During interphase, the chromosomes are tightly bound and visible under a light…

A: Interphase is the major part of the cell cycle and incorporates the stages as G1, S and G2 stages.…

Q: 22

A: The objective of the question is to match the given molecules with their respective definitions or…

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity. Complementarity is…

Q: In the next experiment, MCF-7 cells were treated or not with indibulin and the effect of this drug…

A: Question: Comment Figure 4 globally (make the parallel between the left images and the graph on…

Q: Consider mitochondrial inheritance in the family shown below. (No one is shaded-in because we are…

A: As mitochondria contain their own DNA, which is a tiny circular extranuclear DNA, they are also…

Q: Question 5 The initiation of protein synthesis or regulation of gene expression can be controlled by…

A: Gene regulation refers to the mechanisms that act to induce or repress the expression of a gene.…

Q: 50. Which of the following represents the inactive X-chromatin in female cells? O euchromatin O…

A: Given: The following represents the inactive X-chromatin in female cells.

Q: Question 3 In DNA, the terms 3' and 5' refer to the O A) bonds that form between adenine and thymine…

A: In the field of molecular biology, understanding the structure and replication of DNA is crucial to…

Q: ow that the human genome has been sequenced, we know that there are fewer than expected protein…

A: The genomes of most eukaryotes including Humans are larger and complex than those of prokaryotes.…

Q: QUESTION 40 If we had 6 different DNA/RNA nucleotide bases, strings of how many nucleotides would be…

A: Amino acids are the monomers for the formation of peptides or proteins having a chiral carbon with…

Q: DNA is chemically stable than RNA due to the on

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie…

A: PNA peptide nucleic acid is the artificial Nucleic acid structurally similar to nucleic acid.

Q: Identify which mutagen is described by the following statement. Inserts between adjacent bases in…

A: Certain chemical mutagen can insert between adjacent base pairs of DNA molecule e.g., proflavine…

Question

Genetics Question 24

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Similar questions

Question 1 A G What is the sequence of the sample DNA submitted for sequencing given the gel electrophoresis profile from the Sanger sequencing method? || | | | ||
Genetics Question 11
Question 1. Enzymes, proteins and deoxyribonucleic acid (DNA) macromolecules. Enzymes are not only speed up the reaction, but also are necessary for DNA repreduction. are important biological a) Compare the process of protein synthesis between eukaryote mRNA and viral RNA b) With the aid of a diagram, draw an adapter molecule that recognizes the codons of mRNA and explain its functions in DNA translation.
Question 6. List the five steps in cell migration in order:
Question 8. In what region of DNA do regulatory transcription factors bind? Short Answer
Question 10. What molecule in the cell is the first to recognize the signal peptide as it is translated by the ribosome?
Question 4
Question in photo
Question 5B
QUESTION 14 The octamer core of nucleosomes contains: 4H2A, 4HB, 2нз, 2H4 b. 2H2A, 2HВ, 2HЗ, 2H4 С. 2H1, 2H2A, 2нВ, 2НЗ O d. 2H1, 2H2A, 2HB, 2H3, 2H4
Question 10. Where do regulatory transcription factors bind relative to a gene sequence?
Question 6. If cells are infected with a vesicular stomatitis virus (VSV) strain in which a viral gene (VSVG) is fused to the green fluorescent protein gene, when the chimeric protein is synthesized, what compartments will it visit and in what order before until it leaves the cell?