QUESTION 1 Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTC.    1. Sometimes, a mistake occurs in the translation of an mRNA strand. Suppose that the reading of the mRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codon would be AUA. Write the sequence of amino acids that would be formed. 2. Suppose the bases of the DNA strand in question 1 were not transcribed correctly and the mRNA read: CACAUGGUUAGUAAGCAG How many mistakes were made in transcription? Wite the abbreviations for the amino acids  that would be formed by translation of the mRNA

Q: E) Suppose you isolate a mutant mouse that has white eyes. When you examine the size of the eye…

A: The correct mRNA transcript would include all the exons combined together and introns being…

Q: Another name for the RNA polymerase recognition/binding site upstream of a gene is the O a. promoter…

A: Introduction :  In transcription process RNA polymerase binds to the DNA upstream of the gene at a…

Q: Question 1: tRNA and amino acyl tRNA synthetases Part g: What chemical and structural characters are…

A: Part g: There are several chemical and structural similarities between the amino acids Ile…

Q: Question 27 To make RNA the nucleic acid sequences get read in the directi -- Sense → Antisense O…

A: Nitrogen-containing bases, phosphate groups, and sugar molecules make up nucleic acids. Each nucleic…

Q: Q-2: (a): The diagram below symbolizes different regions along a gene encoding a mRNA. Translation…

A: AUG is the sequence of the start codon. An mRNA will have the sequence AUG in many places, but only…

Q: If you were to observe the activity of acetylated DNA, you would expect it to: O be very actively…

A: As DNA is wrapped around the histone proteins;to form a more compact structure inside the…

Q: Question 28 The anticodon of a tRNA is 5'UUG. What codon(s) can be theoretically recognized by this…

A: RNA is a type of nucleic acid which is comprised of single standard poly nucleotide chain and…

Q: Question 1. What recruits the enzymes that form the 7-methylguanosine 5' cap on the transcript as it…

A: Primary transcript, also known as heterogeneous nuclear RNA (hnRNA), refers to the initial RNA…

Q: QUESTION 4 Which type of mutation will affect not only the amino acid encoded by the affected codon,…

A: Frameshift mutation can change every amino acid after the point of mutation . It caused by deletion…

Q: Scenario 2: Examine the following DNA strand. The coding strand is on top and the template strand…

A: DNA is a template for making proteins that are essential for cellular functions. The process of…

Q: Consider the gene that encodes telomerase RNA. Suppose that the sequence of the template strand that…

A: DNA is composed of nucleotides. There are two purine bases - -Adenosine (A), and Guanine (G), and…

Q: Question 9 5 pts 95 58 40 HS SH HS 8 M urea and 65 72 B-mercaptoethanol 65 26 Hs84 Hs HS HS 110-SH…

A: According to the Anfisen experiment of the protein folding, the disulfide bond can be disrupted by…

Q: Question 9 Which of the following is the missing link between DNA and Proteins according to the…

A: Central dogma  Central dogma a pictorial representation of genetic material which tells us how a…

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: Explain why the image below could not be from a eukaryote. What characteristics of the image would…

A: Eukaryotes are organisms that has nucleus and organelles within the cell. Nucleus is enclosed in the…

Q: Question 3. Why must RNA splicing be absolutely precise?

A: RNA Splicing refers to the removal or cutting of non-coding regions of RNA (introns) from mRNA and…

Q: Which one of these mutations would definitely NOT affect the function of the protein coded by the…

A: Mutation is defined as the event where the gene sequence of the DNA is altered giving rise to…

Q: QUESTION 4 Suppose you have a length of DNA sequence that corresponds to a complete mRNA open…

A: Q4. The correct option is D i.e, look for splice sites GT-AG thise should only be present if the DNA…

Q: QUESTION 3 You are given the below piece of DNA (the same as the question above): GCCGTACCGATAC…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is made up of two…

Q: What is the amino acid attached to the tRNA with the following anticodon: CAG Glutamine Valine…

A: In thе fiеld of molеcular biology and gеnеtics, thе intricaciеs of protеin synthеsis hingе on a…

Q: Mutations - Create a nonsense point mutation in this coding region of the gene. Make sure to…

A:

Q: tretch of DNA that is comprised of 500 nucleotides is a Gene

A: The DNA( Deoxyribonucleic acid) is made up of repeating units of the nucleotides, hence these are…

Q: Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: 1. Below is a gene on DNA in a prokaryotic cell. Draw the mRNA molecule that would be made from this…

A: It can exist in various forms like primary, secondary and tertiary based on its level of…

Q: None

A: Let's address each question one by one :     Question 1Select  corresponding sequence from  sequence…

Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG

A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…

Q: Question 1: The c-myc gene has several exons. What are the stages of the maturation process that its…

A: Introduction - The cellular equivalent of the retroviral v-myc oncogene, the c-myc gene, was found…

Q: Question 1 of 10 Question 1. You isolate a mouse Tau-gene-containing DNA fragment from the chicken…

A: Heterogeneous nuclear RNA (hnRNA) is a pre mRNA formed after the transcription of DNA. This is…

Q: Question 10. A mRNA contains a codon with the sequence 5'-GAA-3'. Answer A and B for credit. A. What…

A: DNA acts as genetic material in almost all living organisms. It is a self replicating molecule. mRNA…

Q: 18

A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…

Q: Question 6. How does the sequence of the primary transcript resemble the sequence of the gene…

A: A primary transcript is the single-stranded ribonucleic acid (RNA) product synthesized by…