Question 18 Listen You have the following DNA sequence 5'ACCTGTGCAATATACGGCCAT 3' If the A in bold is mutated into a T, what will happen to the protein that would be made from mRNA transcribed from the DNA? The chain would be the same length, but more than one amino acid would be different from the original sequence The amino chain would be longer than the amino acid chain of the original sequence The amino acid sequence would not change at all from the original sequence One amino acid would change, the rest would stay the same relative to the original sequence The amino chain would be shorter than the amino acid chain of the original sequence

Q: pro-ser-cys

A: The given peptide is made up of three amino acids that are proline, serine, and cysteine. All of…

Q: 4 Label the dingm ing plan nd body potion teilgy Calar the pium acingt the ly pded in the le belew…

A: Introduction: Anatomy is that branch of medical science that describes the location and structure of…

Q: What made the statement wrong?

A: Answer :- Yes , the restriction cloning process, both the plasmid and the DNA sequence of interest…

Q: D O Thomson Higher Education Which letter indicates the site of filtration? A O B Oc O D O E

A: The kidney is the versatile organ responsible for excretion. It has further distinct minute…

Q: FLG I_ K

A: Human muscular system:The muscular system is made out of particular specialized cells known as…

Q: Name plz

A: The long narrow and coil part of alimentary system that starts just below the stomach where both…

Q: 1404

A: These Plants are green plants which have pointed and small leaves.

Q: Dog

A: Animal are the organism which consists of sub unit of animal cell. The cell wall is not found in…

Q: of the following images show a carbohydrate? Note: molecular biologists have many different ways o…

A: Biomolecules are the molecules of life. Small sized biomolecules are called as biomicromolecules.…

Q: cation a

A: Mutation: It is defined as ,any change in the genetic material of an organism that gives rise to…

Q: Performing a Hernia assessment

A: A hernia can be defined as the abnormal exit of a tissue or an organ. Typically, hernias involve the…

Q: CH3CO3H

A: The given reaction is a reaction of ketone and per acid. The product of this reaction is an ester.…

Q: Figure 8.12 In the accompanying figure, the green rectangular shape represents_ O a. DNA…

A: All genetic information are stored in DNA, which is present in nucleus  in case of eukaryotic cell…

Q: Which letter represents the destination for molecules that get reabsorbed? E A-

A: The urinary system help in the elimination of waste substances from the body.  The kidney is the…

Q: Sequelae definition

A: When activity of one or more organ is disrupted then it is characterized by sign and symptoms,this…

Q: 9. Structure IV in Figure 12-2 represents a(n)

A: Transcription is the formation of RNA from DNA.It occurs in the nucleus of the cell. The translation…

Q: Let's say this graph shows the relationship between snakes (predator) and mice (prey). Describe what…

A: In an ecosystem, species interact with each other within their ecological-webs and this interaction…

Q: What is Babinski's sign? What condition might lead to an abnormal finding?

A: Ans. Reflex, also known as a reflex action, is an uncontrollable, unplanned series of actions that…

Q: 38

A: The given figure is the cross section of a male reproductive system .