Q: QUESTION 4 The following diagram represents double-stranded DNA that is part of the RNA-coding…
A: QUESTION 1: The question is asking which strand is the non-template strand, the strand on the top or…
Q: just answer the questions nothing to conpl
A: Approach to solving the question: Offspring-List the phenotypes (both color & number) The…
Q: . List the parts of the light reactions that are proteins. List the parts of the light reactions…
A: Step 1:Photosynthesis is a process in which plants, algae, and some bacteria convert sunlight,…
Q: Q11. One of the two genes known to be mutated in cases of Hypokalemic periodic paralysis (which is…
A: CACNA1S is a gene that encodes the alpha subunit of the L-type voltage-dependent calcium channel,…
Q: QUESTION 1 Questions 1-5. Please fill in the blank below with the corresponding structures indicated…
A: Solution:
Q: Questions are in the image
A: 1) Human Growth Hormone (HGH) is a hormone produced by the pituitary gland that plays an important…
Q: A haploid E. coli cell has the genotype I ¯ P+ O+ Z+ Y ¯ where the I ¯ indicates that the repressor…
A: The question is asking us to determine which statements are correct about an E. coli cell with a…
Q: Kingma et al. (2011) found that in the purple-crowned fairy-wren, most subordinate helpers at the…
A: The study by Kingma et al. (2011) revealed an intriguing observation in the purple-crowned…
Q: 8. The time of the incubation for the serial dilution experiment should be ___ hrs.: a) 12 b) 24 c)…
A: Question 8 Explanation: The appropriate time for incubation in a serial dilution experiment depends…
Q: What types of early adaptation measures should be prioritized in national adaptation plans or…
A: The objective of the question is to identify the types of early adaptation measures that should be…
Q: The mechanism by which DNA is licensed to replicate only once during each S phase involves ORC and…
A: Option A: This option is incorrect because ORC and helicase loaders do not bind to geminin during…
Q: Explain the reasons why cream cheese is a high risk food for the elderly and pregnant women. The…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: fueled.brightspace.com/d2l/le/enhancedSequenceViewer/3300467?url=https%3A%2F%2Ff59af8a9-95f5-419c-a4…
A: The objective of the question is to identify the most accurate statement about gene expression and…
Q: What are the 9 essential Amino Acids?What are the benefits of each to humans.
A: Amino acids are organic molecules that serve as the building blocks of proteins, which play critical…
Q: Se
A: In the Galapagos Islands, we can see that various types of finches are found. These finches have…
Q: Please help
A: Step 1:Q.1.1 Here is your answer:Sa ≤s person Data Analysis for Ba ≤ Pty Ltd.Comp ≤ t ∈ gthe Tab ≤…
Q: d.cyberhigh.org/Course.aspx?courseVersionid=232&unit=8&courseCode=biology-b&pid=536971&req-quiz8949&…
A: The principle that is NOT part of the Hardy-Weinberg Equilibrium is:In a finitely large, randomly…
Q: No need guidelines answers
A: let's take a methodical approach to dissecting the reasons for each of the genetic situations that…
Q: 1. Suppose that the three samples are from two parents and their child. Which individuals are the…
A: Approach to solving the question:Blood types are determined by the presence or absence of certain…
Q: please answer the following: 1. how would each be distributed and please complete the chart2.…
A: which is a diagram about the crossing of Species X and Species Y, here's how the chromosomes would…
Q: Air pollution was one of the first areas of environmental concern and regulation. Identify any such…
A: Addressing air pollution comprehensively is crucial not only for safeguarding public health but also…
Q: What phylum is a ray in?
A: Detailed explanation: Taxonomic Classification of Rays: A Comprehensive Overview:This research…
Q: Given that the extracellular concentration of Cl- is approximately 120 mM, what is the intracellular…
A:
Q: Part 1: Use this image to describe the relationship between H, F. and D, including how closely they…
A: Detailed explanation:let's dissect each part of the question based on the hypothesized phylogenetic…
Q: The gel image below shows 7 alleles, let’s call them 1-7 in order of size, with 1 being the largest…
A: Detailed explanation: Let's delve deeper into how to analyze a gel electrophoresis image to…
Q: Which of the following is the definition of a gene pool? The combination of alleles that an…
A: The objective of the question is to identify the correct definition of a gene pool from the given…
Q: Can you please give a basic information on Sertraline?
A: Sertraline is a type of medication known as a selective serotonin reuptake inhibitor (SSRI). It's…
Q: 1. Many cancers can be found early if people would participate in early detection. say your opinion…
A: 1. Lack of awareness and education: People may not be aware of the signs and symptoms of cancer or…
Q: Write about Pfizer-BioNTech COVID-19 vaccine (Tozinameran) You must include the following…
A: Drugs are fundamental for preserving wellbeing, controlling symptoms, treating diseases, and…
Q: 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to…
A: PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…
Q: Total Number of Tree Snails (N) 500 300 200 8888888 700 600 400 100 0 1997 1999 2001 2003 2005 Year…
A: Based on the choices given to explain why the population of tree snails experienced a drop after the…
Q: s EOC Problems 11-16 Question 9 of 15 ► eBook O Problem 11-16 - Dividend Discount Model In three…
A: Step 1:We have to calculate the value of the stock. For this, we have to calculate the value of the…
Q: write the different types of carbohydrates. List 6 examples of carbohydrates that you eat and state…
A: Carbohydrates:Essential biomolecules that provide energy for the body.Types of Carbohydrates:Simple…
Q: Multiple fission within the parental bacterial cell leads to a formation called: a) Glial tissue b)…
A: The question is asking about the result of multiple fission in a bacterial cell. Multiple fission is…
Q: Homo floresiensis describe the fossil/ DNA etc. and where it comes from. Describe what makes this…
A: Homo floresiensis, often referred to as the 'Hobbit', is a species of small archaic human that…
Q: Based on the attached figure (Fig. Box 18B of the textbook), what is the output structure of the…
A: Let's analyze the options and discuss why each one is correct or incorrect: Step 1: A.…
Q: Briefly describe at least two upper respiratory tract infections caused by each of the following…
A: The explanation for the chosen upper respiratory tract infections (URIs) and their causative agents…
Q: make sure it’s correct i need asap and make sure to answer all
A: Comparison:Mass: Species T is significantly larger than Species P, which may confer some advantages…
Q: STEM Workplace Practices
A: The concept of Design of Experiment (DOE) and how it can be applied in process development.Objective…
Q: Name: Kian Hamilton Period: 8th Using Punnett Squares to do a Monohybrid Cross You can use a Punnett…
A: Links for…
Q: 9. Here is a restriction map for a bacterial plasmid showing the cleavage sites for two different…
A: In that case, let's proceed with the study of the gel lanes and the treatments that correspond to…
Q: Which of the following statement regarding the whole-pathogen vaccine is/are correct (B) Live…
A: In order to tackle this question, it is crucial to comprehend the attributes of live attenuated and…
Q: Your collaborator from Fisk University has isolated proteins from healthy prostate cancer cells.…
A: <p>First, you need to quantify the proteins isolated from both healthy and prostate cancer…
Q: How could one use the Agrobacterium tumefaciens method to introduce scent (as from a rose) into a…
A: The objective of the question is to understand how to use the Agrobacterium tumefaciens method to…
Q: Ss x SS What are the phenotypes of the parents ____ and _______? In words, what are the genotypes?…
A: In genetics, we have the concept of phenotype and genotype. Genotype refers to the set of genes…
Q: Nitrogen Content Assay Method II l is also known as? Micrometric Method Semimicro Method…
A: Deciding the nitrogen concentration of a material is fundamental within the region of chemical…
Q: How does light pollution negatively impact sea turtles? Explain
A: Overall, light pollution poses a significant threat to sea turtles by disrupting their nesting…
Q: Human Skin Color: Evidence for Selection Name: Jayden Bodisto Make observations of the Figure below.…
A: The objective of the question is to understand the relationship between UV radiation and skin color,…
Q: 1.) An increase in volume H 1 ! 80 888 F1 F2 F3 F4 F5 ALWAYS results in an increase in pressure.…
A: 1. Relationship Between Volume and Pressure:The statement "An increase in volume ALWAYS results in…
Q: The graph below represents the growth of a population of flies in a jar. Which letter best indicated…
A: Deer Population Dynamics: In any ecosystem, the population of a species, like deer, is influenced by…
Step by step
Solved in 2 steps
- Second Letter U A G | Phe UCU UUC UUA Tyr UGU UGC Cys /u Stop UGA Stop | A Stop UGG Trp G UUU UAU UAC UCC Ser | UCA UAA Leu UUG UCG UAG CU Leu ccc CAU CAC CAA CUU His CGU CUC CGC | Arg | C Pro CUA CCA Gln CGA A CUG CCG CAG CG AGU Ser U AUU AUC ACU ACC AAU Asn Thr AAC AAA lle AGC AUA АCА AGA | Lys A Arg G AUG Met | ACG AAG AGG GUU GUC GCU GAU GAC Asp GGU GGC GGA U Val |GCC GCA Gly C A Ala GUA GAA Glu GUG GCG GAG GGG GINVESTI-BANK LaB-AIDS INCORPORATED 11:35 AM December 17 DANT 1271SC35Second letter UGU UGCCYS UCU UAU UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp UUU Phe UUC. UCC Ser UCA UUA Leu UUG S UCG CAU CUU CUC Leu CỦA CGU CCU CC ССА CCG His CAC CGC Pro Arg CAA CGA Gln CUG CAG CGG AGU AGC AGA AAU ACU ACC ACA AUU Ser AUC File A AUA Asn AAC. AAA AAG Thr Lys AUG Met ACG AGG Arg GCU GCC GCA GCG GGU) GGC Gly GUU GUC Val G GUA GAU) Asp GAC Ala GAA Glu GAGJ GGA GUG GGG A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5'. What is the codon on an RNA strand transcribed from this series of nucleotides? Which amino acid results from this codon? Use the genetic code to answer this question. Edit View Insert Format Tools Table 12pt Paragraph Av ev T? MacBook Pro 20 00 000 23 $ % & 7 First letter Third letter * OC 全
- Second letter U A G UUU Phe UUC, U UUA UCU) UCC UCA UAU UAC FTyr UGU] UGCCYS UUG FLeu UCG, Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CAU 1 CGU CGC Arg CUU CCU His CÁC S САА CỤC ССС Leu Pro CỦA ССА CGA CUG CCG CAG GIn CGG AAU LAsn AGU ], AUU ACU* AUC }ile A AUA АСC АСА ААС AAA Ser AGC. AGA Thr JArg AUG Met ACG AAG FLys AGG GAU ASP GACS GAA GAGJ Giu GGG) GUU GUC - Val GUA GCU] GCC GGU GGC Ala Gly GCA GGA Glu GUG GCG Given the double-stranded DNA molecule shown below, what is the sequence of the mRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAАTTTAAATTT -3' Template strand 3'- АТАСТТТАААТТТАAA — 5' а. What are the amino acid sequences encoded peptides by the three possible reading frames? Please write your answer like this: Pro-His-Stop-Leu etc. Reading frame 1 starts with the first 5' nucleotide. ORF1: Enter your answer here ORF2: Enter your answer here ORF3: Enter…11C UUU UUC Phe UUA UCU) UCC UCA UAU UAC Tyr UGU UGC Cys Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG FLeu UCG CUU CUC CCU] СС CAU1 CAC САC His САА Gln CGU CGC Arg Leu Pro CUA CUG ССА CGA CUG J CCGJ Which of the following tRNA anticodons could theoretically base pair effectively with the codons 5'-AAU-3' and 5'-AAC-3' through third-base CAG, CGG AGU AAUASN AGC AUU AUC File A AUA ACU АСС АСА AAC FAsn AAA Ser C Thr AGA Arg A AUG Met ACG AAG Lys AGG GCU] GCC GCA GCG GGU GGC Gly GGA GAU1 GUU GUC GUA GUG Asp GACJ GAA C Val Ala A GAG Glu GGG wobble? 5'-GGG-3' OI. 5'-AUG-3' II. 5'-GUU-3' I. 5'-CAT-3' IV. 5'-AAA-3 V. Third letter UCAG UUAG A, First letter
- Second letter A G UCU UCC UAU. Tyr UAC. UUU1 Phe UUC. UUA UUG. UGC Ser }Leu UAA Stop UGA Stop UAG Stop |UGG Trp UCA UCG CAU His CUU CỤC CCU ССС ССА CGU CGC Arg Leu CÁCS Pro CỦA CUG CGA CAAGIN CGG, Gln CAG, CCG J AAU Asn ACU АСC АСА AUU AGU Ser AUC }le A AUA AAC. Thr А AGC AGA AUG Met | ACG ] AAG Lys AG. GUU GUC GCU GAU1 AAsp GACS Ala GAA GGU GGC GCC Val Gly GGA G GUA GCA GUG GCGJ GAG Glu GGG Which peptide is the least likely to be made on the ribosome and why? а. Third letter DUAG 5UAG DUAG DUAG First letterU UUU UAU 11yr Phe UUC UUA Leu UUG Jle UCU UCC UCA UCG UGU UGC Cys UGA Stop UAG Skop UGG Trp UAC Ser UAA Stop CUU CUC CỦA CUG CAU JHis CAC CGU CGC CGA CGG CCC Leu Pro Arg ССА Delete CCA CG CAA CAG JGIN Gln AUU AUC le AUA AUG Met AGU 1 Ser AGC AGA AGGJArg 1. ACU ACC The ACA ACG AAU M AAC AAA AAG Jlys JAun ATG AAC TAC CTA GGG ACA GAU JAsp GAC GAA GAG JGlu GUU GUC Val G GUA GCU GCC GCA Ala GCG GGU GGC Gly ATG ACC TAG GGA CA GGA GGG GUG G. Compare translation before and after the deletion. What effect might it have on gene function? Asp Daspartic acid lleI isolcucine Thr T threonine Leu L leucine Ser S serine Туr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Lys K Arg R Gly G glycine lysine Ala A alanine arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Second Position UGU 1Cy UCU UCC Ser UCA UG UUU Phe UAU UAC Ty UAA Slop UGA Stop UAG Slop UGG Trp UGC UUC U UUA Leu ] low UUG CUU CÚC A Leu CCU CCC Pro…Page 1: Second Letter C 1 2 UUU U UUC UUA Phe UCU UCC UCA UCG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop UGG Tyr -- Ser Leu Stop A Trp G UUG CUU C CUC CCU Leu cc CAU His CGU Pro CAC CGC Arg CUA CUG CCA CCG 1st СА Gln CGA CAG CG 3rd letter AUU A AUC AUA AUG ACU ACC ACA AGU Ser AGC u letter AAU AAC AAA AAG Asn He Thr AGA AGG A Arg G Lys Met ACG GUU G GUC GUA GUG GCU GCC GAU Asp GGU GGC U Val GAC GAA GAG Ala Gly GCA GGA GGG Glu GCG 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5' a. direct transcript? b. transcript for translation? c. direction of a? (3' to 5' or 5' to 3') d. direction of a (3' to 5' or 5' to 3') e. translated peptides?
- Second letter UUU UUC UUA UUG. UCU UCC UCA UCG UAU Tyr UAC. Ser UAA Skp UGIA Stop UGU UGC. Phe Cys Leu UAG Sop UGG Trp CGU CGC Arg CGA CCU CAU CUU CUC CUA CUG His CAC CAA CAG Gin CCC Pro CCA Leu CCG CGG ACU AAUA AGU ]Ser AUU Asn AAC AGC AGA LArg AGG. AUC Be ACC ACA Thr AAA AUA AUG Met ACG MGys GUU GUC Val GUA GCU GCC GCA GCG Ala GAA Glu GAG GAU GAC Asp GGU GGC Gly GGA GGG GUG You come across four polynucleotide strands. The first is an original RNA strand that codes for a protein; the others are similar to the original RNA strand, except that each displays a point mutation. The point mutations are shown in red. 5' - AUG-UGC-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGA-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGC-AUU-CCC-GCA-UAA - 3' 5' - AUG-UGC-GUU-CCU-GCA-UAA - 3' Original RNA: Mutant RNA 1: Mutant RNA 2: Mutant RNA 3: 1. Based on how they will affect the protein product, identify the type of point mutation (missense, nonsense, silent, or frameshift) present in the Mutants 1, 2, and 3. 2. State which of…ScX O 2020/ X Chapt O Pla + x ti Grades x - Micros x Attach x 2 Edpuz x (1) Dia x A quizizz.com/join/game/U2FsdGVkX19u5PV2q0828jgMm6BEgGF6fEPUbfvRFnusX%252BvbgoJX50wVADbL6X.. Johnson - Bo.. A Classes Course stream ti Planner - ProgressB. Holt McDougal Onli. G snake - Google Sear. O YouTube C 2KMTCentral | NBA A Actively Learn 1/7 Streak Whose research suggested that DNA was helical? Chargaff Watson Crick FranklinSecond letter C UUU UGU UGC. UUC Phe UUA UUG UCU UCC UCA UCGJ UAU1 UAC. Ser UAA Stop UGA Stop A Tyr Leu UAG Stop UGG Trp CAUTHIS CACS CAA GIn CAG CGU CGC Arg CCU CUU CỤC CỦA CUG J CC Leu Pro ССА CGA CCGJ CGGJ AGU Ser ACU АСС ACA AUU AAU Asn AAC AAA AUC le AGA TArg Thr AUA AUG Met ACG AAGLYS AGG GAU GUU) GUC GUA GUG GCU) GCC GCA GACASP GAA AGlu GAGS GGU GGC Gly Val Ala GGA GGG GCGJ Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' Third letter UCAC UCAG UCAG UCAG 등 | First letter