Origin of Replication RNA primer 5' 5' femplate strands Leading strand DNA Lagging strand polymerase 3 5' 5' 3' 5 Helicase DNA Okazaki fragment DNA RNA ligase palymerase primer Figure 9.10 A replication fork is formed by the opening of the origin of replication, and helicase separates the DNA strands. An RNA primer is synthesized, and is elongated by the DNA polymerase. On the leading strand, DNA is synthesized continuously, whereas on the lagging strand, DNA is synthesized in short stretches. The DNA fragments are joined by DNA ligase (not shown). You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?

Origin of Replication RNA primer 5' 5' femplate strands Leading strand DNA Lagging strand polymerase 3 5' 5' 3' 5 Helicase DNA Okazaki fragment DNA RNA ligase palymerase primer Figure 9.10 A replication fork is formed by the opening of the origin of replication, and helicase separates the DNA strands. An RNA primer is synthesized, and is elongated by the DNA polymerase. On the leading strand, DNA is synthesized continuously, whereas on the lagging strand, DNA is synthesized in short stretches. The DNA fragments are joined by DNA ligase (not shown). You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?

Name: Figure 9.10 You isolate a cell strain in which the joining together of
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated? Origin of Replication

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 8P: Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second...

See similar textbooks

Similar questions

Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI template
This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation due to deletion during replication ?
5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C
Labeling DNA Replication Directions: Drag the lahels from the left tn corrary derti theinats of ar=rlicating strandarA 24 Newly Created Strand of ONA Replication Carke Original DNA Strand Replication Direction of Origin of Replication Directions: Bolow is a more in-depth look at a replication bubble. A.l of the psrts are still tne came, but
AKS 5c: Which student correctly explained what is occurring in the images? AEGCEE ECCUAE FACGAAAGCAEA 3' Met Leu Ser Tyr Tyr Gle Ser le Met Leu Ser Tyr Tyr Glu Ser le The 4th student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being O lined up for semi conservative replication. The second arrow must demonstrate the process of transcription since the DNA is being read at the ribosomes and the monomers of protein are being connected. The 1st student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being lined up for semi conservative replication. The second arrow must demonstrate the process of translation since the RNA is being read at the ribosomes and the monomers of protein are being connected. The 2nd student explains the first arrow must demonstrate how the base pairing rule
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
1) Fill in the following replication bubble. Be sure to draw and label the origin of replication (both sides), the leading and lagging strands, & the 5' and 3' ends of alI DNA fragments. 5' 3'
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
BamHI site BamHI site kanT 3755,6p 784 bp PAMP 4539 bp 2332 pp PKAN 4207 bp HindllI site 1875 bp amp HindlII site Origins of replication You are using these two plasmids to make a recombinant DNA molecule. You want to make a molecule, that has two origins of replication and is amp but NOT kanR, using only one fragment from each plasmid. How large, in base pairs, will be your desired recombinant DNA molecule? O 6087 base pairs O 5630 base pairs O 2659 base pairs O 8746 base pairs 47 8 24 & 4. 8. 9. 4 5 6 RI T 13 H. 2 K FL
NAME Tarissa shyll CENTRAL DOGMA REVIEW REPLICATION Use the DNA code provided and fill in the complementary DNA strand. Which nitrogen base CAN'T you use during replication? Uracil ATTCGATGC TACGGATCG TRANSCRIPTION Use the DNA code provided to copy an m-RNA message. Which nitrogen ase CAN'T you use during transcription? ACTGGATAC ACGGAT CGT CERDANCE TRANSLATION: USE the DECODING WHEEL to DETERMINE the AMINO ACID that corresponds to the m-RNA CODE GIVEN mRNA CODE AMINO ACID AAA GCG GAU CAA CAC UUU Which two mRNA codes correspond to histidine? GACU How many different mRNA codes correspond to Threonine? 2 CAGTGACTT TGACAGCTA Which amino acids have ONLY ONE codon? COTGOHGUCAG|UC|AGUCAGS GU AC CUGA U/G/ACU GACUCAK Alanine Valine Arginine Serine ان داد Lysine Asparagine A Threonine Serine Tyrosine Stop Cysteine Stop Tryptophan Leucine TOPPLY Histidine Proline
Origin of replication [ Choose ] [Choose] Codon Complementary pairs with cytosine in a DNA molecule The site of protein synthesis Ribozyme This molecule can begin the synthesis of a polymer of nucleotides without a primer A short peice of lagging stand DNA Primase A reflection of redundancy in the genetic code RNA which exhibits enzymatic properties Okazaki Fragment The process of making RNA from DNA Helicase DNA polymerase Transcription Enzyme which lays down a segment of RNA on replicating DNA so that DNA nucleotides can polymerize A sequence of three nucletotides which codes for an amino acid Ribosome Point Mutation Chromosome Wobble Position The point on a stand of DNA where replication begins Mitochondria RNA polymerase [ Choose ] Guanine