The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.

Q: You are studying a large eukaryotic gene that is 439,515 base pairs long. You find the polypeptide…

A: As proteins are polymers of amino acids, the chemical composition of the amino acid side chains and…

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…

A: Introduction  A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: Will an insertion or a deletion of three nucleotides result in a frameshift mutation? Explain why or…

A: The frameshift mutation is the mutation by which the amino acid frame is changed. It is usually…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which  RNA transcript is formed from DNA. Various type of RNA are…

Q: You want to clone the Human Gene A into a plasmid for producing the Protein A in bacteria. GeneA…

A: Introduction :- A plasmid is a small, circular, double-stranded DNA molecule that is separate from…

Q: Using a table that shows which codon represents which amino acid determine the following:   A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some…

A: A codon is a sequence of three nucleotides (a triplet) that encodes a specific amino acid or signals…

Q: Insulin is a peptide hormone encoded by the INS gene, which is on chromosome 11. Insulin is produced…

A: The hormone insulin is required by the body to reduce the level of blood glucose. The pancreatic…

Q: a)  One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: ou have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100…

A: Natural selection is a theory that states that organisms evolved by changing their heritable traits…

Q: Let’s suppose that a vertebrate organism carries a mutation that causes some cells that normally…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: There may be more than one correct answer for each Which of the following motifs can be found in…

A: Introduction :- A motif is a short, recurring sequence of nucleotides in DNA or amino acids in a…

Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…

A: Ans - a.)  5’- G A G C G A T C G C T C - 3’                       3'- C  T C G C T A G C G A G -5'…

Q: Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some…

A: Mutations are changes that occur in the DNA sequence of an organism. They can arise spontaneously…

Q: The following DNA sequence is found on a chromosome in rice plants:               5’…

A: Given DNA sequence:  5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…

Q: Which of the following is a reason why codons are NOT composed of only two nucleotides? Question 22…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: The coding DNA strand of a gene has the following DNA sequence:  5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: A diploid human cell contains approximately 6.4 billion base pairs of DNA. Assuming that the linker…

A: Nucleosomes are the structural units of DNA which are made up of the basic repeating subunits of…

Q: Given that there are about 20,000 human genes, how can human cells make 75,00o-100,000 different…

A: Given questions: How human cells make different proteins Difference between missense and nonsense.…

Q: Scientists have observed that individuals with LOW birthweight are MORE likely to become obese as…

A: The experiment performed to observed that individuals with LOW birthweight are MORE likely to become…

Q: Let us suppose that a vertebrate organism carries a mutation that causes some cells that normally…

A: The addition of methyl groups into DNA molecule is called DNA methylation. The activity of the DNA…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.