Nucleotide Position 10 15 Sequence 1. ... T CT GGATCATCACAT. .. Sequence 2. Sequence 3. Sequence 4. Sequence 5. ACA G C AT CATTAC GT... T C AGG AT CAT TACAT. .. T C A GG ATCAT TACAT. .. ACA GC ATCAT TACGT. .. T C T G GATCATCACAT. .. T C AGGATCATTACAT. .. Sequence 6. . Sequence 7. Sequence 8. .. ACAG CATCATTAC GT. ..

Nucleotide Position 10 15 Sequence 1. ... T CT GGATCATCACAT. .. Sequence 2. Sequence 3. Sequence 4. Sequence 5. ACA G C AT CATTAC GT... T C AGG AT CAT TACAT. .. T C A GG ATCAT TACAT. .. ACA GC ATCAT TACGT. .. T C T G GATCATCACAT. .. T C AGGATCATTACAT. .. Sequence 6. . Sequence 7. Sequence 8. .. ACAG CATCATTAC GT. ..

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 3SQ

See similar textbooks

Similar questions

A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAAWhich of the following mutations would cause a missense mutation in the sequence shown above? Select one: a. Replacement of second thymine base with cytosine base b. Replacement of second guanine base with thymine base c. Replacement of last adenine base with guanine base d. Replacement of first guanine base with adenine base
AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acids
The top side of this figure offers more opportunities (for each base pair) that can lead to highly specific protein-DNA interactions. True or False? Major groove Major groove (a) Major groove Major groove O True N-HI110 O False A NIIH-N Minor groove Adenine-Thymine CH3 0111H-N H₂C OFITH 98 TN- GN-HIIN V-HillO Minor groove Guanine Cytosine Minor groove Thymine-Adenine Hillo C NIH OIH -NG Minor groove Cytosine Guanine
A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first cytosine base with guanine base b. Replacement of final thymine base with guanine base c. Replacement of second guanine base with cytosine base d. Replacement of first thymine base with adenine base
1. Using the following DNA sequence determine the amino acid sequence: 3'TACCAGAGGTCCGCGTTTAGACAT5' a. Met Val Ser Arg Arg Lys Ser Val b. Val Leu Pro Gly Arg Lys Ser Met c. Met Ser Lys Arg Gly Pro Leu Val d. Val Ser Lys Arg Arg Ser Val Met I know the answer is A, but how do I do it? indicate if each statement refers to prokaryotic cells, eukaryotic cells or both. 1. leading and lagging strands form during DNA replication c 2. 80S complete ribosomal subunit 3. DNA replication is coordinated to the cell cycle. 4. Circular DNA
of estion 9 t of uestion THCA ▶ Sou 100- HC This reaction is Entropy is THC San Leafly ATA RNA polymerase SSSSSSSSSS ATTOGOGACATAA ATGACGGATCAGCCOCAAG UACUOCCUAGUC RNA Transcript TACTOCCTAGTCGGCOTTCOOCTTAACCOCTOTATIT (In this picture, RNA is being made by complementary base pairing with DNA.) This reaction is → Entropy is ◆
Give the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
1. Label the drawing at the right with the terms nucleotide, base pairing rules, and double helix. Write each term and draw a line that connects the term to the appropriate part of the drawing. AX P 010101010 80 Р PDP TCXA D. D C GXC P 0 CXG P P D A ICXA D P G D D CXG D TCXA DL D TCXA 0101010 D CXG P AXT D P P P P D 0 D P P P GCD LON A
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?
28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm5s²UAA.