NASA sends a mission to Mars that brings back a new life form!  It is carbon-based and its genetic material is similar to Earth DNA except that it uses 6 different nucleotide bases instead of 4.  Its proteins are also similar to those on Earth, but there are 60 different amino acids instead of 20.  In order to study this new life form further, the National Science Foundation asks you for your ideas about the genetic code for this organism. How many spaces would you propose are in each codon of the genetic code for this new organism?  Why?

Q: Electrostatics has an important role to play in modern molecular biology. Explain this statement.

A: Introduction: Electrostatics is a branch of physics that explains the interaction between two…

Q: Researchers isolated a gene for a membrane protein and from that the amino acid sequence was…

A: Post translational modification results in the chemical modification and folding of protein so, that…

Q: Which statement best describes how Watson and Crick's model used other scientists' work to create a…

A: According to Watson and Crick's model, the strands of the DNA are twisted around each other in order…

Q: Match the term with the best description meaningful sequence of nucleotides in a nucleic acid…

A: The above questions are answered as follows -

Q: They want to insert a small sequence into the gene which will be read in the same frame, so that it…

A: The expression of a protein occurs in two steps. Transcription: The gene is transcribed by RNA…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Deoxyribonucleic acid is a molecule made out of two polynucleotide chains that curl around one…

Q: 2' HO 5' OH-3' -OH-3 |3' M O A represents Group I introns and B represents spliceosome introns O A…

A: Here,the answer is A represents Group II introns and B represents Group I introns. Group I and Group…

Q: AKS 5a: Use the table below to answer the question that follows. Trout are a fish that are closely…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: What is the structure being described? b. What is the chemical composition of this structure? c.…

A: A bacteria is a prokaryotic organism that it has a simple genetic material and the cellular…

Q: What results would you expect if the bacteriophage that Hershey and Chase used in their experiment…

A: Alfred Hershey and Martha Chase conducted an experiment and concluded that DNA is the genetic…

Q: Nucleic acids are isolated and analyzed from different cells in a mammal. How would the DNA sequence…

A: The DNA sequence of a skin cell would be similar to that of a nerve cell. Since, both of them are…

Q: beadle and tatum proposed the one-gene-one-polypeptide hypothesis. is this true for prokaryotes and…

A: The central dogma of molecular biology states that DNA contains instructions for making a protein…

Q: Explain all point of question with proper answer.

A: Living organisms contain DNA (deoxyribonucleic acid) as the genetic material that is present within…

Q: Genes are tightly packed in a structure of DNA and histones, known as nucleosomes, that form what…

A: 1. The double helical DNA gets wrapped around the histone protein. 2. The nucleosome structure is…

Q: (Claim) Summarize scientist's error in naming noncoding DNA "junk" DNA.  (Evidence) Is the amount of…

A: 1. The non-coding DNA is initially called as 'junk' DNA that means it doesn't have any roles in the…

Q: The Selfish Gene is a radical theory that argues that all living creatures are essentially vehicles…

A: This is a question about the relevance of the concept of the selfish gene, as put forth by Richard…

Q: For you, what is the contribution around 18-1900 of golden era in biochemistry? Explain

A: Introduction: The term biochemistry refers to the study of the chemistry of living things including…

Q: What was the Mendel’s definition of a gene? How was it different from the definition by Beadle and…

A: Please note that keeping with regulations the first 3 questions (actually 5) are answered below,…

Q: Would genetic engineering be possible if we did not know a great deal about the genetics of…

A: Answer- Genetic engineering is the process by which foreign DNA is incorporated in the desired DNA…

Q: Random mutations only very rarely result in changes in a protein that improve its usefulness for the…

A: Introduction: The genome of every human is different because of the occurrence of mutations taking…

Q: how, exactly, does DNA profiling work? Given a sequence of DNA, how can forensic investigators…

A: DNA stands for Deoxyribonucleic Acid. It carries the genetic information of a particular…

Q: The RNA World Hypothesis suggests that the earliest forms of life used RNA as a genome instead of…

A: The RNA World Hypothesis is a theory that explains how life on Earth arose from basic chemistry. One…

Q: Chimpanzees and gorillas are genetically similar, sharing more than 98 percent of their DNA. While…

A: Comparative anatomy is the study of the "similarities and dissimilarities" between various objects.…

Q: Figure 1-13b shows the human chromosomes in a singlecell. The green dots show the location of a gene…

A: The somatic cells are diploid that means they have 2 sets of chromosomes inherited one from each…

Q: A group of scientists was able to make inferences about the genetic code and central dogma processes…

A: The genetic code is a set of rules that determines how genetic information is encoded in the DNA…

Q: What happens in translocation during protein synthesis? * Answer in 3-5 sentences only. Your answer…

A: Carbohydrates, proteins, lipids, and nucleic acids are the four major macromolecules found in all…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: 1 bp of DNA is approximately 0.34 nm in length. Abacterial chromosome is about 4 million bp in…

A: Bacteria are microorganism that most commonly occur in the soil, air, water and in adverse…

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: I wanted to know where in the concepts of genetics 12th edition book can I find the answer to my…

A: The genetic code is a set of laws that define how DNA's four-letter code is converted into amino…

Q: Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In…

A: The genes are the functional part of the DNA that are responsible for the production of RNA by the…

Q: In Oct 2022, a chilling discovery was made in Vuvatu, a country known for its extensive volcanic…

A: The objective of the question is to provide an explanation that supports the extraterrestrial origin…

Q: Why are consensus sequences found in cis-elements typically only 5-6 bases long? Question 19…

A: The consensus sequence is the calculated order of most frequent residues, either nucleotide or amino…

Q: If you are given a sample of chromosomal DNA, what experiment could you perform to determine whether…

A: The main difference between prokaryotic and eukaryotic. DNA is that prokaryotic DNA is found in the…

Q: I am studying pancreatic islet cells and have isolated, cloned, and sequenced a novel protein that…

A: A transmembrane refers to a protein or molecule that spans the cell membrane, extending from the…

Q: You are studying a bacterial metabolic pathway that results in the synthesis of a product, vitalin,…

A: Mutants means tbe strain of the bacteria lacking the gene expressing for that particular enzyme.…

Q: 18

A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…

Q: What is DNA and RNA? How are DNA and RNA different? Do you think there are any organisms on the…

A: It contains the genetic information for the functioning of the organism. It contains two strands.…

Q: What is the meaning of translation in molecular biology?

A: The literal meaning of translation is conversion of data from one language to another. This is the…

Virus

Viruses are infectious microscopic agents that can only reproduce in live cells of animals, plants, or microbes and are smaller than bacteria. Vertebrates, invertebrates, plants, protists, and fungi are among their many hosts. Viruses are unable to multiply on their own due to the lack of necessary cellular machinery, but they can guide the cell machinery of a host to make additional viruses by infection. The virus enters and attaches to a particular host cell, injects its genetic material, and reproduces by using the host’s genetic material. Viruses cause infection by taking entry into the host cell and using the host cell’s enzymes and raw materials to multiply.