Why are consensus sequences found in cis-elements typically only 5-6 bases long? Question 19 options: because 6 specific nucleotides is so unique that you would never find the same 6 nucleotides anywhere else in the genome. because they don't want to be too specific because it developed that way by random chance through evolution because only 5-6 bases are exposed to one side of the DNA helix because proteins are very small and can only span 5-6 bases

Q: Match the vocabulary word with the proper definition: enzyme that joins two pieces of DNA ✓ first…

A: DNA and RNA are two types of nucleic acids that are essential for life. They are composed of…

Q: Which of the following about the DNA synthesis reaction is false? O Phosphodiester bond formation…

A: DNA replication is the process by which DNA duplicates itself using DNA as a template and DNA…

Q: Question 2. You have a wild-type strain of E. coli with the genotype A B C D E F You introduce an F+…

A: Bacteria undergo conjugation in which they transfer the part of the chromosome or the plasmid from…

Q: Below is a segment of DNA which you wish to amplify using PCR (polymerase chain reaction). The…

A: The DNA polymerase always bonds with the free 3'-OH of the primer and elongated the new DNA strand…

Q: Structure and Function of DNA and RNA

A: DNA and RNA are nucleic acid which is comprise of nucleotide base (adenine, thymine, guanine,…

Q: 3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the…

A: Nucleic acid are main the information carrying molecules of the cell which consists of a ribose…

Q: To maintain uniform diameter of the DNA double helix, only purines base with each other via two…

A: DNA is the fundamental structure that carries all the information of a living thing. In most cases,…

Q: the study of whole sets of genes and their interactions | Choose the application of computational…

A: Answer :  1) the study of whole sets of genes and their interactions - genomics.  2) the application…

Q: Genes are tightly packed in a structure of DNA and histones, known as nucleosomes, that form what…

A: 1. The double helical DNA gets wrapped around the histone protein. 2. The nucleosome structure is…

Q: Question 1    DNA replication is said to be semi-conservative because   Question 1 options:   each…

A:

Q: Question 39

A: DNA sequencing is the process of determining the sequence of nucleotides (adenine, guanine,…

Q: Question 1 Listen You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is…

A: Transcription and translation are the fundamental processes by which cells interpret and utilize the…

Q: GQ2

A: The objective of the question is to determine the type of mutation that would occur if a specific…

Q: Question 3 Not yet answered Points out of 1.00 P Flag question Which of the following have…

A: Nucleic acids are the molecules that cells use to store, transfer and express genetic information.…

Q: Cis-elements such as Response Elements found in DNA and are bound by proteins are usually ________ .…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Which of the following descriptions of regions A, B, and Care INCORRECT? A = minor groove, sugar…

A: On one side of the helix, the strand backbones are closer together than on the other. When the…

Q: To answer the prompts below, draw on a piece of paper or your tablet the chemical structure of the…

A: The trinucleotide sequence is:5' - TCA - 3'The complementary trinucleotide sequence will be:3' - AGT…

Q: 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of…

A: Sickle cell anemia is a disease caused by a mutation of the gene coding for hemoglobin leading to…

Q: QUESTION 4 Which of the following DNAs is most likely to contain the recognition sequence for a…

A: DNA (Deoxyribonucleic acid) recognition sequence is a specific linear sequence that is recognized by…

Q: Question 32

A: RFLP or restriction fragment length polymorphism is a technique in molecular biology that makes use…

Q: Which of the following have nitrogenous bases correctly paired in DNA? Select one: O a.…

A: DNA or deoxyribonucleic acid is the genetic material of most living organisms except for certain…

Q: Question 35

A: A DNA (deoxyribonucleic acid) library is a comprehensive collection of cloned DNA fragments from a…

Q: Question 3 In the polymerase chain reaction A conditions must be carefully controlled to prevent…

A: PCR is a technique which amplifies a DNA template or strand to produce thousands number of copies of…

Q: Match term and its description. heat briefly separate DNA strands |Choose cool to allow primers to…

A: PCR ( polymerase chain reaction ) is a methodology involving synthesis of numerous duplicates or…

Q: Question 4. Why is a single-stranded, circular DNA an ineffective template for DNA polymerase?

A: Introduction Single-stranded DNA is a DNA molecule that has only one nucleotide strand while…

Q: What type of chemical bonds hold together a DNA double helix? weak hydrogen bonds between…

A: DNA It is one of nucleic acid that constitutes two polynucleotide chains. These chains coil around…

Q: There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA…

A: The cellular functions are regulated/controlled by the DNA present within the nucleus of the cell.…

Q: Answer the following: 1. Which pieces of DNA are the most informative? Why? 2. Explore the concept…

A: The process of determining the sequence of nucleotide bases (As, Ts, Cs, and Gs) in a molecule of…

Q: QUESTION 9 VMD can be used to do pairwise sequence alignments between two sequences with BLAST. True…

A: The field of molecular interaction has been widened with the use of computer tools. The different…

Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…

A: Complementary DNA  Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…

Q: Question 36

A: The word oligo in Oligonucleotide stands for scanty or few. Oligonucleotides are the moieties that…

Q: Question 29 DNA polymerases have an intrinsic 3' → 5' exonuclease activity with a proofreading…

A: (Note: According to the given guidelines, we are supposed to answer only one question. Please repost…

Q: the synthesis of mRNA from

A: outside (cytoplasm).-In DNA, uses nucleotide sequence to prepare the mRNA "blueprints." The mRNA…

Q: 18

A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…

Q: These correct “overwinding” ahead of the replication forks by breaking, swiveling, and rejoining DNA…

A: DNA is the type of genetic material present in the organisms like humans and plants. The structure…

Q: cis-elements in RNAs

A: Answer: Cis-acting regulatory sequence elements are sequences contained in the 3′ and 5′…

Q: G-C A-T OT-A N-C C-G H N=C N-HO Which DNA base pair is represented in this figure? N-HIN HIN I H C-H

A: The monomeric units of DNA or deoxy nucleic acid are called nucleotides. Nucleotides are phosphate…

Q: A) How many origins of replication do you think the viral genome has, and why do you think this? B)…

A: Introduction Replication is a process by which DNA strands synthesize a complementary strand of…

Q: 2 a- b- Nucleic acid chemistry Why does lowering the ionic strength of a solution (decrease the salt…

A: DNA is the nucleic acid that acts as the genetic material of life forms. It is a primarily a polymer…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.