Which of the following is FALSE regarding primase? O It synthesizes primers on the leading and lagging strands. It requires a promoter. It uses DNA as a template. It synthesizes RNA 5' to 3'. O It catalyzes formation of phosphodiester bonds.
Q: Which of the following is true of the Calvin cycle? Antioxidants and xanthophylls can reduce the…
A: Photosynthesis is the process which is responsible for synthesis of glucose from the carbon dioxide,…
Q: Which of the following about the DNA synthesis reaction is false? O Phosphodiester bond formation…
A: DNA replication is the process by which DNA duplicates itself using DNA as a template and DNA…
Q: Listen The patient has been ordered to receive dopamine 400 mg/250 mL D5W to be infused at a rate of…
A: Answer. Given data :-----Available dopamine concentration = 400 mg / 250 ml D5W. Infusion rate = 5…
Q: Which of the following is false regarding mRNA processing? O The poly A tail that is found on the 3'…
A: mRNA processing mainly involves 3 steps- splicing addition of 5'end cap and 3'end polytail A…
Q: 2. Is the Mueller-Hinton Agar (MHA) a complex or defined medium? Explain based on its composition.…
A: microorganisms are grown in laboratory using growth media . usually these media are having the…
Q: Which of the following has more than one membrane (choose the most complete answer)? All organelles…
A: As we know all living entities have basic structural and functional unit which is cell. There are…
Q: Which of the following microscopy approaches would work best for imaging a large protein complex…
A: Microscope is an instrument which is used to magnify the size of an object. We can see smaller size…
Q: Which of the following is false regarding DNA repair mechanisms? DNA ligase is needed to establish…
A: DNA repair is a process by which a cell identifies and corrects damage to the DNA molecules. Most…
Q: You are in the lab, and you wish to repeat Avery's experiments. Which of the following mixtures…
A: Avery, Macleod, and McCarty performed an experiment to prove what is the genetic material in living…
Q: Which of the following statements is true? Plasmodesmata are able to only transport small molecules…
A: Cell junctions are structures that help in contact or adhesion or communication between neighbouring…
Q: If you didn't know the sequence of the segment of DNA you want to amplify, how would you perform the…
A: Polymerase chain reaction is defined as the type of laboratory technique where it is used to amplify…
Q: When do cells switch from cellular respiration to fermentation? When NADH and FADH2 supplies are low…
A: Cellular respiration is the process by which the chemical energy present in the O2 molecule is used…
Q: Of the following DNA sequences which would you expect to have the highest melting temperature in its…
A: Melting temperature is defined as the temperature at which a double-stranded DNA molecule will break…
Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…
A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.
Q: Which of the following is FALSE regarding primase? It synthesizes primers on the leading and lagging…
A: Replication is the process during which DNA is replicated into the daughter DNA with the help of…
Q: Which of the following is true in regards to mutagenesis? Mutations occur because of a selective…
A: The process of altering genetic information of an organism through mutation is referred to as…
Q: Extension Questions 14. Other polar molecules include nucleic acids and some proteins. Look at the…
A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms.…
Q: Match the names of the structures with their labels. Lacuna Lamellae Osteocyte [Choose [Choose…
A: The given diagram shows the Harvesian system in compact bone. The Harvesian canals refer to the…
Q: Read the following statement about carbohydrates. Identify which of the following statements about…
A: carbohydrates are polyhydroxy aldehydes and ketones which are associated with reducing property .and…
Q: Whopper Sandwich Nutrition Facts Serving Size: 1 sandwich / 270g Amount per Serving Calories 670…
A: Calories are a unit of measurement for the energy content of food and beverages. Our bodies store…
Q: The concentration of solutes in Cell X is 13%, but Cell X contains no potassium or magnesium. CelI X…
A: Molecules move across the plasma membrane on the basis of the concentration gradient, from region of…
Q: Alkaliphiles are organisms that thrive in extremely basic environments. Which type of interaction(s)…
A: Alkaliphile is an extremophile that belongs to archae bacteria.
Q: A scientist wants to get a hydrophilic drug to the cytoplasm of the cell. Which of the following…
A: The cell membrane is highly non polar in nature , it will allow only mon polar molecule to pass…
Q: Big Mac Nutrition Facts Serving Size: 7 4/5 oz (219.0 g) Amount per Serving Calories 560 Total Fat…
A: Nutritional requirements refer to the specific amounts of essential nutrients (such as…
Q: The structure of lysine is shown. Lysine has pk-2.18. pk2-8.95, and pkg-10.53. At pH 9.5. the charge…
A: Given; pK1= -2.18 pK2=-8.95 pKR=-10.53 at some given pH.
Q: Which of the following is required in running a PCR reaction? Promoter Primase DNTPS DNA polymerase…
A: PCR is polymerase chain reaction , which is a biotechnology tool used in DNA amplification.
Q: Covalent bonds can be formed in each of the following situations except between dCTP and dTTP in a…
A: A covalent bond is formed by sharing of electrons between two atoms. Examples of covalent bonds are…
Q: Read the statements below about membrane transport. Identify the statement that is true. The…
A: Thier are different mechanism of transport of molecule in the cell . Some use energy whike other…
Q: What happens when an excited electron is passed through electron acceptors in the electron transport…
A: The electron transport occurs during light reaction in the chloroplast.
Q: 26. Liver cell makes some enzymes with the endomembrane system and transports the manufactured…
A: Endomembrane system is formed by some cell organelles to perform a special function like vesicle…
Q: You PCR amplify a gene as a test for a mutant version. The unmutated gene (wild type) will yield a…
A: Polymerase chain reaction or PCR is a technique widely used to make huge number of copies of a DNA…
Q: Figure 3 shows a replication bubble. The small black box in the bubble represents a primer. New DNA…
A: DNA replication does not start at random location but ate particular sites, called the origins of…
Q: The diagram below shows a DNA replication bubble. The circles indicate the origin of replication.…
A: Replication is the process of synthesis of new strand DNA from their parent strand. whereas…
Q: When PSI is exposed to sunlight, electrons are excited. What is ultimately responsible for the…
A: Photosystems are the functional units for photosynthesis. These are defined by a specific pigment…
Q: For the past several months, a 24-year-old male has experienced fatigue, puffiness, and overall…
A: The disorder affecting this individual is nephrotic syndrome. Nephrotic syndrome is a collection of…
Q: Below is a 6 base sequence of DNA. What type of mutation would result if the fourth nucleotide base…
A: Transcription is the process by which DNA is used to make mRNA . the mRNA Is later translated to…
Q: Glycolysis is regulated by the enzyme phosphofructokinase 1 (PFK), which catalyzes the formation of…
A: Glycolysis is the process which is responsible for breakdown of glucose into two molecule of…
Q: Question no 9 please help asap
A: We can say that the term homeostasis can be described as a biological system's ability to maintain…
Q: Rank the following molecules from lowest to highest potential energy. 1. ATP 2. CO2 3. NADH 4. G3P…
A: Answer is 2, 1, 3, 5, 4
Do question 17
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following is/are true? 1. Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty acid chains. 2. When the 3' -ATCGGCTAC-5' IS TRANSLATED THE COMPLEMENTARY STRAND 3'-TAGCCGATG-5' IS PRODUCED. 3. A single change in amino acid can give rise to a multifunctioning protein. 4. A complementary RNA strand is produced during translation.Which of the following statements about a transversion mutation in the sequence AGC is true? It could result in a single base substitution to give the new sequence AGT. A transversion mutation in the sequence AGC would always be silent. sequencelt could result in a single base substitution to give the new codon GGC. It could result in a single base substitution to give the new sequence AAC. It could result in a single base substitution to give the new sequence AC.Identify whether each of the following descriptions applies to typical prokaryotic genomes only, typical eukaryotic genomes only, both, or neither, according to lecture. Answer options may be used more than once or not at all. Composed of double-stranded DNA only. Each chromosome has a centromere. Species with larger genomes have more genes. [Choose ] [Choose ] prokaryotes only neither eukaryotes or prokaryotes eukaryotes only both prokaryotes and eukaryotes [Choose ]
- Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram. Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA? during initiation during elongation during termination during protein releaseWhich of the following statements about a transition mutation in the sequence CGG is true? sequenceIt could result in a single base substitution to give the new codon CCG. It could result in a single base substitution to give the new sequence AGG. It could result in a single base substitution to give the new sequence TGG. A transition mutation in the sequence CGG would always be silent. It could result in a single base substitution to give the new sequence GGG.Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram. Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA? A - during initiationB - during elongationC = during terminationD = during protein release
- An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg)if the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
- Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.Which of the following statements most accurately describes the action of the enzyme RNA polymerase?Select one 1.) RNA polymerase will transcribe only the exons by skipping over the introns within a eukaryotic gene sequence 2.) RNA polymerase will transcribe both DNA strands, moving in the 3' to 5' direction for one strand and 5' to 3' on the other 3.) RNA polymerase will transcribe both DNA strands, but only one RNA molecule will be used during translation 4.)None of the statements accurately describe the function of RNA polymeraseThe following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…