n HW assignment i RNA down stream from poly A signal sequence is cleaved RNA pol II physically removed from DNA Termination factors may bind to RNA pol II complex Exonuclease stops RNA polymerase Exonuclease degrades transcript in 5' to 3' direction RNA pol II is destabilized Elongation factors disassociate from RNA pol II Saved Allosteric model Torpedo model < Prev. 14 of 27 Next >

n HW assignment i RNA down stream from poly A signal sequence is cleaved RNA pol II physically removed from DNA Termination factors may bind to RNA pol II complex Exonuclease stops RNA polymerase Exonuclease degrades transcript in 5' to 3' direction RNA pol II is destabilized Elongation factors disassociate from RNA pol II Saved Allosteric model Torpedo model < Prev. 14 of 27 Next >

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

In Figure 8-6, describe where the gene promoter islocated.
During the transcription elongation step, an internal structure in the RNA Polymerase called _______________________ guides the template and non-template DNA strands through channels inside the enzyme. rudder alpha sigma flap zipper
Group I and II introns are present in the following classes of RNAS. MRNAS O MIRNAS SİRNAS TRNAS
In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In your response, include the following: - differences in what structures (DNA, RNA, proteins etc...) are involved - differences in timing and location - DO NOT include any details on what happens after transcription
In this section, please change the underlined portion to make the statement TRUE. Please note: this is different from how True/False questions have been done previously, where you had to indicate whether the statement was true or false. For this exam, please assume that all statements are false, and correct the underlined portion to make the statement true. Question 48 During MRNA splicing, U2 binds to the 3' splice site. Blank # 1 Blank # 2 Question 49 The loss of electrons from an atom is called reduction. Blank # 1 Blank # 2
Fill in the table below to differentiate the process of transcription between prokaryotes and eukaryotes.
The most common type of termination signal in E. Coli is a symmetrical inverted repeat of GC rich sequences followed by about 7 As that forms a stable stem-loop structure in the RNA, which disrupts its association with the DNA template and terminates transcription. true or false
Explain the difference between prokaryotic and eukaryotic transcription. In 3-4 sentence
Which of the following sequences would most likely be the site of the initiation of transcription? ТАТАААТА GCTAGCTA GGCGGCCC Impossible to tell
A string of 8 adenine nucleotides in the mRNA is required for function of an intrinsic transcription terminator in bacteria. True False
Write out the sequences of the two conserved elements in the following bacterial promoter. The startpoint of transcription is shown in red. TGCTTGACTCTGTAGCGGGAAGGCGTATTATGCACACCGCG
In eukaryotic transcription, which of the following is not included in the initiation of transcription? Group of answer choices RNA polymerase II TATA box Holoenzyme AAUAAA consensus sequence