In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In your response, include the following: - differences in what structures (DNA, RNA, proteins etc...) are involved - differences in timing and location - DO NOT include any details on what happens after transcription
Q: The recognition sequence to which RNA polymerase binds at the initiation of transcription is found…
A: Ans- False The recognition sequence to which RNA polymerase binds at the initiation of transcription…
Q: Is chromatin structure is altered in transcription? Explain
A: Solution- Chromatin- It is a thread like structure in nucleus. it's uncondensed molecules of DNA…
Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…
A: Replication, transcription, and translation are used by all cells to keep track of their genetic…
Q: complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with…
A: PPE stands for a promoter-proximal element which is an additional promoter that contains AT-rich…
Q: Which of the following statements regarding complementary molecules in transcription is false?
A:
Q: Unlike transcription in most prokaryotes, transcription in eukaryotes Group of answer choices makes…
A: Transcription is a molecular process in which DNA is transcribed into mRNA. This process occurs both…
Q: What is the production of RNA called and what is the enzyme that catalyzes the process?
A: Nucleic acids are the type of biomolecules that forms the genetic system of almost all living…
Q: List five events other than transcription initiation thatcan affect the type or amount of active…
A: A eukaryotic cell contains a nucleus, membrane-bound organelles, and cytoplasm which are enclosed by…
Q: What are some of the main differences between transcription in prokaryotes and in eukaryotes? List…
A: Transcription is DNA dependent RNA synthesis. Transcription is catalyzed by RNA polymerase enzyme.…
Q: What are the events in the following phases of Transcription: Initiation, Elongation and…
A: Transcription is the process of generating RNA from DNA. Gene expression is another name for it.…
Q: Fill in the following chart regarding the Central Dogma: Transcription Translation Goal…
A: Central dogma refers to the flow of genetic information that is the expression of genes in an…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is…
A: For termination of mRNA sequence a stop codon has to be present it can be UAG UAA UGA
Q: Explain using leucine zipper motifs as an example, how protein-protein interactions between…
A: DNA is the genetic information that a cell obtains from its parents. DNA contains a specific…
Q: Explain what would happen during transcription if the following events took place: If the TATA…
A: Transcription: The process of copying of genetic information present in DNA to RNA with the help of…
Q: lthough the transcription start site begins at the underlined C/G, which of the following is the…
A: Answer- Transcription is the synthesis of mRNA from the coding strand of DNA by the help of RNA…
Q: During the elongation phase of transcription, what molecule is being made? What enzyme is…
A: Transcription is the process in which RNA is formed from DNA. It happens in both prokaryotes and…
Q: The following sequence is a mutant version of the above gene that is present in a mutant bacterial…
A: As required, only E and F has been answered.
Q: Please answer fast What role do sigma factors play in prokaryotic transcription? Which sigma factor…
A: In prokaryotes (as in eukaryotes), transcription necessitates a partial unwinding of the DNA double…
Q: Assume that this DNA molecule is from a bacterial cell. Draw the approximate locations of the…
A: Transcription is the process of copying genetic information from DNA (Deoxyribonucleic acid) into…
Q: Discuss the eukaryotic transcription process and mention the enzymes and components needed in the…
A: Cell is the basic structural and functional unit of life. All cells contains nucleus within which…
Q: During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order to
A: This topic is based on transcription bubble.
Q: Listed below are steps in the transcription process. Reorganize the list so the steps in the…
A: Correct steps of Transcription are as follows. 1. General Transcription factors bind TATA box…
Q: Match the given step with the major central dogma event being referred to. The U2 snRNP binds to the…
A:
Q: The basal transcription apparatus is composed of a. five general transcription factors. b. RNA…
A: Transcription is the process of gene expression. In this process, a gene is read by the…
Q: process of eukaryotic transcription in detail and mention the specific enzyme
A: Transcription can be defined as the process of copying genetic information from one strand of the…
Q: What is required for transcription to proceed
A: The process of transcribing a section of the DNA into RNA is known as transcription. The messenger…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: Choose all of the following that you think are correct Protein(s) that play a role in initiating…
A:
Q: This diagram shows a double-stranded section of DNA. The arrow indicates location and strand of the…
A: Transcription is the process of formation of mRNA using DNA as template. This is possible with the…
Q: What is the correct order of events during transcription Group of answer choices a. Initiation,…
A: Transcription is the process in which the mRNA is formed from the DNA by the process of…
Q: What are the specific steps of eukaryotic transcription? Be sure in your discussion that you include…
A: Transcription is the process which consist of several steps of DNA based gene expression.Here a…
Q: Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is…
A: A mutation occurs when the sequence of bases in DNA or RNA changes. Evolution requires mutations to…
Q: Which of the following components is involved in the initiation of transcription? Group of answer…
A: Reply and Explanation: 1 Record begins when a record factor ties to the advertiser alongside a RNA…
Q: Discuss in detail the process of transcription. proper explanation and diagram
A: Ans: Transcription: The synthesis of mRNA from DNA using RNA polymerase is referred to as…
Q: How would transcription be affected in eukaryotic cells if Mediator was deleted? Group of answer…
A: Introduction: The process involving the copying of the stored information in the strand of DNA or…
Q: TRUE OR FALSE Errors in transcription can lead to silent mutations encoding the same amino acid or…
A: Silent mutations are the type of mutations in which base substitution has no effect in…
Q: Discuss the three steps of eukaryotic transcription.
A: Transcription is the process of making an RNA copy of a gene sequence. The copy of RNA called a…
Q: Based on your understanding of transcription, place the following events in the correct order.
A: The act of transcribing information from a strand of DNA into a new messenger RNA molecule is known…
Q: Please explain: Transcription-what is it and what does it involve? What happens at initiation,…
A: Transcription is the process by which DNA is copied or transcribed to mRNA, which carries the…
Q: TACGGTACGATT CYTOPLASM Transcription a. On the diagram, draw a circle around the part that…
A:
Q: Mention two effects that phosphorylation of the CTD tail of RNA polymerase II has on the…
A: The CTD is expanded as a C-terminal repeat domain. It is a type of unusual extension that has a…
Q: The sigma factor protein's role in transcription in E. coli includes which of the following?…
A: Sigma factors are subunits of RNA polymerase in bacteria. They control synthesis of RNA intitiation.…
Q: Heparin is a polyanionic polysaccharide that blocks elongation by RNA polymerase. But heparin…
A: Heparin is an anticoagulant which is commonly used to prevent blood clotting. This is composed of…
Q: Which of the following among A- C is not needed for bacterial transcription?
A:
Q: Where does transcription happen? Your answer
A: Transcription is the process of the production of mRNA from DNA.
Q: Which of the following statements is true about transcription & translation? O a Ineukaryotes,…
A: According to the Central Dogma of Molecular Biology, DNA generates RNA, which in turn generates…
Q: Which of the following sequences would most likely be the site of the initiation of transcription?…
A: Transcription is carried out by RNA polymerase II. Transcription factor for polymerase II D(TFIID)…
Q: Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is…
A: The C is replaced by A due to substitution mutation in the 5' to 3' strand of the DNA.
Step by step
Solved in 2 steps
- Which of the following is NOT true of eukaryotic response elements (RE)? options: their distance is usually flexible (distance-independent) they regulate how much transcription will occur they specify which strand of DNA is the template strand they are usually orientation-independentIdentify whether each of the following descriptions applies to typical prokaryotic genomes only, typical eukaryotic genomes only, both, or neither, according to lecture. Answer options may be used more than once or not at all. Composed of double-stranded DNA only. Each chromosome has a centromere. Species with larger genomes have more genes. [Choose ] [Choose ] prokaryotes only neither eukaryotes or prokaryotes eukaryotes only both prokaryotes and eukaryotes [Choose ]Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the requested format of your answers. Do not consider any RNA or protein processing events in your answers. transcription terminates promoter (transcription initiates here) 3'-TACATGGAGGGTCGTACTAATTATGGATCTAGTTATCATGTA - 5' 5' - ATGTACCTCCCAGCATGATTAATACCTAGATCAATAGTACAT-3' 2 1. The type your answer... I strand will be used as the template for transcription. (enter only top or bottom; any deviation from this answers will receive no credit. The sequence of the RNA encoded by the gene is type your answer... Type in only the nucleotide sequence of the RNA in the 5' to 3' direction (do not label the ends or add any punctuation marks or spaces). The sequence of the protein encoded by the gene is type your answer... Type the protein sequence using the single-letter amino acid abbreviations from its N to C terminus. Do not label the ends or add any spaces or punctuation marks! #♡ 3 4 % 5 here ↓ < 6…
- Why do prokaryotic organisms translate mRNA molecules while being transcribed? Group of answer choices Prokaryotes lack nuclear membranes to separate DNA and mRNA from protein-synthesizing equipment. Prokaryotes use reverse transcriptase to simultaneously translate and transcribe mRNA. Prokaryotes use pre-mRNA to translate, while transcription occurs within the cell. Prokaryotes have functional mRNA that yields portions of the transcribed mRNA into the cytoplasm to allow for translation to occur.You are treating a patient suffering with wound botulism in which Clostridium botulinum grows in a wound and makes a protein exotoxin, botulinum toxin. In addition to surgery to clean the wound and providing botulinum antitoxin, you wish to give the patient antibiotics to stop the protein toxin synthesis immediately. Which of the following antibiotics would you NOT give your patient if you wished to immediately stop bacterial translation? (best answer) O macrolides, e.g. erythromycin O trimethoprim plus sulfa drugs e.g. sulfamethoxazole O chloroamphenicol tetracylines aminoglycosides e.g. gentamicinGive 7 examples where a specific nucleotide sequences/elements are recognized by protein or protein/RNA complex, from lecture 3.1-3.6. at least one examples from prokaryotic transcription, eukaryotic transcription, RNA processing, RNA stability, translation respectively. For each example, list the specific DNA/RNA sequences/elements and the protein or complex. E.g. eukaryotic promoter, transcription factor, transcription initiation.
- Please describe in detail the process of translation for a Prokaryotic cell, from initiation of translation to termination of translation.Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleusThe use of a DNA template to make a messenger RNA product molecule is a process referred to as: reverse transcription (using the RNA-dependent-DNA-polymerase enzyme) transcription (using the DNA-dependent-RNA-polymerase enzyme) self-replication (using the DNA-dependent-DNA-polymerase enzyme) translation (using the large and small ribosomal subunits) reverse translation (using the small and large ribosomal subunits)
- Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material must be replicated with high fidelity and great speed. Eukaryotic mRNA is said to be polycistronic since they encode multiple polypeptide chains RNA-synthesis occurs inside the nucleus while protein synthesis in the cytoplasm of eukaryotic organisms. Write T if the statement is true and write F if the statement is falseRefer to the sequence below to answer the following questions. 5’- CACTTTTCAACTTGGCAGAAGCAATGTATCTCCGGATATAATCGCTTTCGAATTCG- 3’ 3’- GTGAAAAGTTGAACCGTCTTCGTTACATAGAGGCCTATATTAGCGAAACTTAAGC- 5’ Is the sequence from a bacterial or a eukaryotic cell?Identify the characteristics that support the rationale for your decision. Which DNA strand serves as the template for transcription?The "TATA box" is a [DNA, RNA, Carbohydrate, protein] sequence known as a [promoter, start codon, n-terminus, 5' end] that signals areas where [translation, transcription, replication, protein sequencing] should begin.