Multidimensional Array Enhanced For-loop Input Scanner method using Case-statements Simple AI as machine input 1. Declare a multidimensional array of char to draw a table -+-+- -+-+ 2. Use the enhanced for-loop to display the table for (char[] row:charName) { for (char c:row) System.out.print(c); System.out.println (); 3. Initialize some value (inside the table) in the array charName [0] [0] = '1'; 4. Using Scanner for user input and case statement to put some character inside the table Scanner scan = new Scanner (System.in); int pos = scan.nextInt (); 5. Create some method/function to be used to add functionality to the application program. 6. Add simple AI (for machine input) 7. Using Arraylist to scan patterns in the multidimensional array.

Multidimensional Array Enhanced For-loop Input Scanner method using Case-statements Simple AI as machine input 1. Declare a multidimensional array of char to draw a table -+-+- -+-+ 2. Use the enhanced for-loop to display the table for (char[] row:charName) { for (char c:row) System.out.print(c); System.out.println (); 3. Initialize some value (inside the table) in the array charName [0] [0] = '1'; 4. Using Scanner for user input and case statement to put some character inside the table Scanner scan = new Scanner (System.in); int pos = scan.nextInt (); 5. Create some method/function to be used to add functionality to the application program. 6. Add simple AI (for machine input) 7. Using Arraylist to scan patterns in the multidimensional array.

Computer Networking: A Top-Down Approach (7th Edition)

7th Edition

ISBN:9780133594140

Author:James Kurose, Keith Ross

Publisher:James Kurose, Keith Ross

Chapter1: Computer Networks And The Internet

Section: Chapter Questions

Problem R1RQ: What is the difference between a host and an end system? List several different types of end...

See similar textbooks

Related questions

Q: Explain why you cannot use a range-based for loop on dynamic arrays.

A: Explanation: Dynamic array is an array which allocates memory at the run time with the help of…

Q: Flowchart please

A: I have make flowchart in word file so you can understand better here we need to make 3 flowcharts…

Q: In this lab you will create an integer array and will populate it via user interaction. Type up the…

A: Complete Java Code is given below:

Q: Computer Science Flowchart for this code Please C PROGRAM: #include unsigned int x; sbit P11 = P1^1;…

A: Flow chart is given below

Q: Write a method called myMethod that takes in a two-dimensional integer array int [] [] nums and...…

A: We need to design Java methods to perform the mentioned operations on a 2D array nums.

Q: Query Board Python or Java(Preferred Python please) Thank you! Programming challenge…

A: Matrix: A matrix could be a assortment of numbers organized in rows and columns.The elements of the…

Q: Data structures flip_matrix(mat:list)->list You will be given a single parameter a 2D list (A list…

A: Solution : # This function will reverse a number def reverse_number(num): rev_num = 0 #…

Q: nt array[] = {1. 2, 3}:

A: Here array "array" is an array of integer.

Q: Searching Arrays This lab will you show you how to search an array to see if a number entered by a…

A: Here is your output with the program:

Q: Describe how to work with dynamic arrays.

A: Dynamic arrays Dynamic arrays are those arrays which are allocated memory at the run time with the…

Q: extern "C" int f(int *,int,int); int a[2][2] = {{11,12},{21,22}}; void setup() {…

A: This code is an example of an Arduino sketch written in C/C++ language, which makes use of assembly…

Q: In this lab, you use what you have learned about searching an array to find an exact match to…

A: #include <iostream>#include <string>using namespace std; int main() { string…

Q: double size = 5; %3D double array[size] = {0.25, 0.5, 0.75, 1.0, 1.25, 1.5}; %3D

A: The above question first declare a variable named size which contains value 5. Now this variable is…

Q: -PROGRAM C 2. ElementSearch Write a C program that will search a value in the array. Input 1. n…

A: PROGRAM INTRODUCTION: Include the required header files. Start the definition of the main function.…

Q: The following deﬁnition has errors. Locate as many as you can. A) void showValues(int nums) {for…

A: A) void showValues(int nums) {for (int count = 0; count < 8; count++) cout << nums[count];}…

Q: CFG: Example 1 • Draw the CFG for the following code: int f(int n){ } int m = n* n; if (n < 0) else…

A: CFG for the code has been written in step2

Question

Multidimensional Array
Enhanced For-loop
Input Scanner method using Case-statements
Simple AI as machine input
1. Declare a multidimensional array of char to draw a table
-+--
-+-+-
2. Use the enhanced for-loop to display the table
for (char[] row:charName)
for (char c:row)
System.out.print(c);
}
System.out.println ();
3. Initialize some value (inside the table) in the array
charName [0] [0]
'1';
4. Using Scanner for user input and case statement to put some character inside the table
Scanner scan = new Scanner (System.in);
int pos = scan.nextInt ();
5. Create some method/function to be used to add functionality to the application program.
6. Add simple AI (for machine input)
7. Using Arraylist to scan patterns in the multidimensional array.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

C++
In visual basic Print out the last value in a single-dimensional array.
// MichiganCities.cpp - This program prints a message for invalid cities in Michigan. // Input: Interactive // Output: Error message or nothing #include <iostream> #include <string> using namespace std; int main() { // Declare variables string inCity; // name of city to look up in array const int NUM_CITIES = 10; // Initialized array of cities string citiesInMichigan[] = {"Acme", "Albion", "Detroit", "Watervliet", "Coloma", "Saginaw", "Richland", "Glenn", "Midland", "Brooklyn"}; bool foundIt = false; // Flag variable int x; // Loop control variable // Get user input cout << "Enter name of city: "; cin >> inCity; // Write your loop here // Write your test statement here to see if there is // a match. Set the flag to true if city is found. // Test to see if city was not found to determine if // "Not a city in Michigan" message should be printed.…
DebugEight4: Here is the code that needs to be debugged, I fixed some but it will not display the words in reverse at the end: // Application allows user to enter a series of words // and displays them in reverse order import java.util.*; public class DebugEight4 { public static void main(String[] args) { Scanner input = new Scanner(System.in); int x = 0, y; String array[] = new String[100]; String entry; final String STOP = "XXX"; StringBuffer message = new StringBuffer("The words in reverse order are\n"); System.out.println("Enter any word\n" + "Enter + STOP + when you want to stop"); entry = input.next(); while(!(entry.equals(STOP))) { array[x] = entry; ++x; System.out.println("Enter another word\n" + "Enter " + STOP + " when you want to stop"); entry = input.next(); } for(y = x - 1; y > 0; ++y) {…
C PROGRAMMING LANGUAGE
C programming
Can you fix the code please on the first picture shows the error output. // Corrected code #define _CRT_SECURE_NO_WARNINGS #include "LibraryManagement.h" #include "Books.h" #include "DigitalMedia.h" #include "LibraryConfig.h" #include #include #include #include // Include the necessary header for boolean data type // Comparison function for qsort to sort Digital Media by ID int compareDigitalMedia(const void* a, const void* b) { return ((struct DigitalMedia*)a)->id - ((struct DigitalMedia*)b)->id; } // initializing library struct Library initializeLibrary() { struct Library lib; lib.bookCount = 0; lib.ebookCount = 0; lib.digitalMediaCount = 0; // Initialize book array for (int i = 0; i < MAX_BOOK_COUNT; i++) { lib.books[i].commonAttributes.id = -1; // Set an invalid ID to mark empty slot } // Initialize ebook array for (int i = 0; i < MAX_EBOOK_COUNT; i++) { lib.ebooks[i].commonAttributes.id = -1; }…
//Assignment 06 */public static void main[](String[] args) { String pass= "ICS 111"; System.out.printIn(valPassword(pass));} /* public static boolean valPassword(String password){ if(password.length() > 6) { if(checkPass(password) { return true; } else { return false; } }else System.out.print("Too small"); return false;} public static boolean checkPass (String password){ boolean hasNum=false; boolean hasCap = false; boolean hasLow = false; char c; for(int i = 0; i < password.length(); i++) { c = password.charAt(1); if(Character.isDigit(c)); { hasNum = true; } else if(Character.isUpperCase(c)) { hasCap = true; } else if(Character.isLowerCase(c)) { hasLow = true; } } return true; { return false; } }
Fix the errors and send the code please // Application allows user to enter a series of words // and displays them in reverse order import java.util.*; public class DebugEight4 { public static void main(String[] args) { Scanner input = new Scanner(System.in); int x = 0, y; String array[] = new String[100]; String entry; final String STOP = XXX; StringBuffer message = new StringBuffer("The words in reverse order are\n"); System.out.println("Enter any word\n" + "Enter + STOP + when you want to stop"); entry = input.next(); while(!(entry.equals(STOP))) { array[x] = entry; ++x; System.out.println("Enter another word\n" + "Enter " + STOP + " when you want to stop"); entry = input.next(); } for(y = x - 1; y > 0; ++y) { message.append(array[y]); message.append("\n"); } System.out.println(message) }
Code in C Code in the file IO: /************************************************************* This program prints a degree-to-radian table using a for- loop structure. The results are printed to a file and the the screen. *************************************************************/ #include <stdio.h> #define PI 3.141593 #define FILENAME "tableD2R.dat" int main(void) { /* Declare variables. */ double radians; FILE *fileout; /* Open file. */ fileout = fopen(FILENAME,"w"); if (fileout == NULL) printf("Error opening input file. \n"); else { /* Print radians and degrees in a loop. */ printf("Degrees to Radians \n"); for (int degrees=0; degrees<=360; degrees+=10) { radians = degrees*PI/180; printf("%6i %9.6f \n",degrees,radians); fprintf(fileout,"%6i %9.6f \n",degrees,radians); } /* Exit program. */ }
Enhanced selection sort algorithm SelectionSortDemo.java package chapter7; /** This program demonstrates the selectionSort method in the ArrayTools class. */ public class SelectionSortDemo { public static void main(String[] arg) { int[] values = {5, 7, 2, 8, 9, 1}; // Display the unsorted array. System.out.println("The unsorted values are:"); for (int i = 0; i < values.length; i++) System.out.print(values[i] + " "); System.out.println(); // Sort the array. selectionSort(values); // Display the sorted array. System.out.println("The sorted values are:"); for (int i = 0; i < values.length; i++) System.out.print(values[i] + " "); System.out.println(); } /** The selectionSort method performs a selection sort on an int array. The array is sorted in ascending order. @param array The array to sort. */ public static void selectionSort(int[] array) { int startScan, index, minIndex, minValue; for (startScan = 0; startScan < (array.length-1); startScan++) { minIndex = startScan; minValue…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…