C++ Code:This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be:name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters./** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs)For example, if the sequence isAACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATGand the vector namesSTRs is {"AGAT", "AATG", "TATC"}, then the output is the vector {3, 7, 4}/** * Compares if two vectors of STR counts are identical or not * * @param countQuery STR counts that is being queried (such as that computed from an input DNA sequence) * @param countDB STR counts that are known for an individual (such as that stored in a database) * @returns a boolean indicating whether they are the same or not **/ bool compareSTRcounts(vector<int>& countQuery, vector<int>& countDB)For example, if countQuery is the vector {3, 7, 4}, and countDB is the vector {3, 3, 4}, the function returns false.

In the context of bioinformatics, it's often necessary to analyze a given DNA sequence to identify…

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs / vector getSTRcounts(string& sequence, vector& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is {"AGAT", "AATG", "TATC"}, then the output is the vector {3, 7, 4} / * Compares if two vectors of STR counts are identical or not * * @param countQuery STR counts that is being queried (such as that computed from an input DNA sequence) * @param countDB STR counts that are known for an individual (such as that stored in a database) * @returns a boolean indicating whether they are the same or not **/ bool compareSTRcounts(vector& countQuery, vector& countDB) For example, if countQuery is the vector {3, 7, 4}, and countDB is the vector {3, 3, 4}, the function returns false.

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Concept explainers

Question

C++ Code:

This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be:

name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5

This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters.

/** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs)

For example, if the sequence is

AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG

and the vector namesSTRs is {"AGAT", "AATG", "TATC"}, then the output is the vector {3, 7, 4}

/** * Compares if two vectors of STR counts are identical or not * * @param countQuery STR counts that is being queried (such as that computed from an input DNA sequence) * @param countDB STR counts that are known for an individual (such as that stored in a database) * @returns a boolean indicating whether they are the same or not **/ bool compareSTRcounts(vector<int>& countQuery, vector<int>& countDB)

For example, if countQuery is the vector {3, 7, 4}, and countDB is the vector {3, 3, 4}, the function returns false.

Expert Solution

Trending now

This is a popular solution!

Step by step

Solved in 5 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.