-PROGRAM C 2. ElementSearch Write a C program that will search a value in the array. Input 1. n Description number of elements to be stored in the array 2. num Description values to be stored in the array 3. x Description value to be searched in the array Output   Enter·number·of·elements:·6 Integer·#1:·0 Integer·#2:·-2 Integer·#3:·1 Integer·#4:·-5 Integer·#5:·12 Integer·#6:·4 Elements·of·Array:·0·-2·1·-5·12·4 Element·to·search·in·the·array:·-5 Found!

C++ Use 2 D arrays String and float Make simple

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…

Language: C++