Instead of randomly placed DNA within the nucleus of a eukaryotic cell, it seems that regions of DNA are specifically placed in exact locations withir the organelle. Which of the following would be an advantage to DNA organization within the nucleus? Organized regions of DNA within the nucleus would aid the cell specifically in preventing viruses from attaching to the DNA Specific regions in the nucleus contains high concentrations of Polymerases and Transcription Factors which would localize DNA Specific regions in the nucleus contains specific portions of DNA and the reason is not yet understood in science Organized regions of DNA would allow for easier traveling of transcription factors and polymerases to the appropriate sites

Instead of randomly placed DNA within the nucleus of a eukaryotic cell, it seems that regions of DNA are specifically placed in exact locations withir the organelle. Which of the following would be an advantage to DNA organization within the nucleus? Organized regions of DNA within the nucleus would aid the cell specifically in preventing viruses from attaching to the DNA Specific regions in the nucleus contains high concentrations of Polymerases and Transcription Factors which would localize DNA Specific regions in the nucleus contains specific portions of DNA and the reason is not yet understood in science Organized regions of DNA would allow for easier traveling of transcription factors and polymerases to the appropriate sites

Name: Instead of randomly placed DNA within the nucleus of a eukaryotic cel
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Instead of randomly placed DNA within the nucleus of a eukaryotic cell, itseems that regions of DNA are specifically placed in exact locations withinthe organelle. Which of the following would be an advantage to DNAorganization within the nucleus?Or

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter4: Cell Structure

Section: Chapter Questions

Problem 17RQ: Which of the following sequences correctly lists in order the steps involved in the incorporation of...

See similar textbooks

Similar questions

A viral mutation that causes changes in the glycoprotein spikes would affect which aspect of the virus? The virus would become lysogenic and incorporate its genome into the host cell genome. The virus would enter the host by a combination of endocytosis and fusion. The virus would lose its viral envelope and become a naked virus. The virus would attach to different host cells and its host range would be altered. The viral genome would not require uncoating once inside the host cell.
O O O A new virus is discovered. Its RNA genome encodes several proteins, including a reverse transcriptase enzyme. What can you conclude about replication of this virus? Its replication involves a double-stranded RNA intermediate Its replication involves a DNA copy of its genome Its replication depends entirely on cellular enzymes Its replication is entirely independent of cellular enzymes 00 A deficiency in Base Excision Repair (BER) would primarily sensitize you to mutations caused by radiation, X-rays O Chemicals in smoke, and UV radiation O Unavoidable, spontaneously occurring DNA damage
Which of the following is a difference between a viroid and a virus? O viroids contain some genes important for their own replication while viruses rely entirely on host cell enzymes for their replication viroids are alive and viruses are not O viroids are not infectious particles and viruses often cause disease O viroids are composed solely of nucleic acid while viruses are composed of nucleic acid surrounded by a protein coat O viroids infect only plants while viruses infect only animals and prokaryotes
You are studying a new retrovirus. The viral protein (X) appears to play a role in the export of the viral genomes to the cytoplasm. Protein X brings viral DNA to the cytoplasm and returns back to the nucleus after genome export is complete. Researchers have developed a new drug for the virus. Following treatment with the new drug, the viral protein stays in the nucleus and cannot export the viral genomes. What is the most plausible and logical function of the drug? Use your knowledge of nuclear transport to answer this question. O A. The drug inhibits the binding of the viral protein and the viral genomes to the import receptor. B. The drug inhibits the binding of Ran-GTP to the nuclear export receptor in nucleus. C. The drug promotes the Ran GAP activity. D. The drug blocks the NLS on the viral protein.
Which of the following functions in the regulation of gene expression? plasmids euchromatin nucleases telomeres nucleoids
Describe the structure of a bacterial genome, and explain how it differs from a eukaryotic genome. Explain what a plasmid is, and describe the role of plasmids in the spread of antibiotic resistance genes. Explain how bidirectional semiconservative DNA replication copies the circular chromosome of a bacterium during cell division. Explain the steps of replication by DNA polymerase, including initiation, elongation, and termination. Explain the different kinds of mutations and how they occur.
Small extrachromosomal rings of DNA, often contain genes that give bacterial cells genetic advantages: * none is correct O chromatin Onucleoplasm nucleoid plasmids
It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).
Microb The origin is the site on the DNA: is ONLY where transcription begins is ONLY where translation begins is ONLY where RNA polymerase initially binds to DNA/gene is where transcription begins AND where RNA polymerase binds initially to DNA/gene is where replication begins AND where helicase binds is ONLY where helicase binds DNA is ONLY where replication begins
Which event in prokaryotes is most like the segregation of sister chromatids in eukaryotic mitosis? Replication beginning at the ori site Replication ending at the ter site Formation of a cell wall The plasma membrane pinching in to form a ring of fibers similar to a purse string O ori regions moving toward opposite ends of the cell
The DNA of prokaryotes differs from that of eukaryotes in that the prokaryotic DNA is . Group of answer choices Converted directly into protein without the use of RNA Exposed directly to the cytoplasm of the cell Separated from the rest of the cell by the nuclear envelope Housed within the nucleoid, a membranous structure inside the cell
BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases