In prokaryotic organisms transcription is initiated: O downstream from a Shine-Delgarno sequence a an AUG sequence O downstream from a Pribnow box and a TTGACA seq nce a stem loop structure O a poly A sequence

Q: 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA..AAAA O 5'…

A: Mature mRNA are those mRNAs that has been spliced and processed and is ready for translation in the…

Q: Select the processes that only happen inside the nucleus of a eukaryotic cell. Select all that…

A: Eukaryotic cells make up the eukaryotic body. These are more advanced organisms because their…

Q: Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA   Hb A…

A: Specific DNA sequences encode hemoglobin, a critical molecule for oxygen delivery in red blood…

Q: Prokaryotic cells can have more than one functional start codon per mRNA because  There are…

A: It is a multiple choice question

Q: O mediator complex O histones RNA polymerase enhancer

A: Transcription is the process by which the information of a strand on the DNA is replicated by its…

Q: Which process is illustrated in the diagram? Pre-mRNA Exon 1 Lariat Exon 1 BEIN Intron Step 1 Step 2…

A: mRNA splicing is a process by which a newly made precursor messenger (m) RNA transcript is…

Q: A given coding strand sequence in a Eukaryote is as follows GGGAATATAA GACCGATGGA GGGTACAG CCCTATCAC…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: The trpL sequence in the trp operon encodes O a poly-A tail addition sequence O rho termination…

A: Answer :- several codons for the amino acid trp  Because the in the  E. coli operon that is the…

Q: Which of the following statements are false about prokaryotic transcription? In bacteria,…

A: Transcription is the production of RNA from the DNA template strand. It is also known as gene…

Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…

A: The central dogma is referred as the central processing system which includes the transfer of…

Q: The chain elongation in transcription continues until a termination sequence is encountered a stop…

A: In transcription , a special sequence contains U rich sequence downstream from a stretch of…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

A:

Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…

A: The ending of termination and the process involved in it are called transcription termination. The…

Q: What is added to the 5' end of eukaryotic mRNAs? a methyl-guanosine CAP a poly-A tail a Kozak'…

A: At first, the terminal phosphate of the three 5′ phosphates connected to the furthest limit of the…

Q: This sequence element is found in RNA and is critical for prokaryotic translation. O Shine-Delgarno…

A: Translation involves translating the sequence of a messenger RNA (mRNA) molecule to a sequence of…

Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…

A: A DNA sequence is transcribed into an RNA molecule with the help of the enzyme RNA polymerase is…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: The arrow in the diagram below indicates the direction of transcription. A BTTT…

A: Q. Ans:- The given image shows the process of transcription. Transcription:- Transcription is a…

Q: Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes…

A: The mRNA at the third position is AUG and it is called Initiation codon.

Q: Name each of the processes pictured: 5'

A: protein synthesis ELONGATION PHASE OR PROCESS SPLICING TERMINATION PHASE OR PROCESS

Q: What is a Shine-Dalgarno sequence? The template sequence found in the RNA part of telomerase A…

A: The correct answer is that the Shine- Dalgarno sequence is a sequence that base- pairs with 3' end…

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Q: Define terms related to Molecular Biology of Transcription and RNA Processing Protein bridge SL - 1…

A: Since there are multiple questions in this particular question, I will answer the first three…

Q: Question 2 coding strand is: 5'-TACGATCATAT-3’. This sequence is transcribed. What is the sequence…

A: During transcription only one strand of the transcription unit is transcribed. Transcript is…

Q: A bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18…

A: Transcription is the process of creating new RNA by duplicating the DNA strand. Transcription is the…

Q: The arrow in the diagram below indicates the direction of transcription. TTT AUGCCGCAAUC B TTT…

A: DNA replication is the process by which a cell copies its DNA prior to cell division. It is a…

Q: 2 3 13 sidering the information, answer the Fowing questions: 5 the trait inherited as dominant or…

A: Pedigree explains the disease outcome or the phenotypic variation for a particular trait in a…

Q: TRP U ARG AC LEU SER U A UG LYS PRO GAC UG GLN HIS THE MET ILE ARG a. lys-leu-cys-phe…

A: The process of the formation of a protein with the help of messenger RNA in the ribosomes is called…

Q: Which of the following changes may cause a gene product to not loose functión? Prevent or reduce…

A: Introns and exons are found in the mRNA transcripts and introns are removed via the RNA splicing…

Q: The following diagram represents DNA that is part of the RNA-coding sequence of a transcription…

A: Transcription is a process through which the template strand of DNA transcribes into mRNA with the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.