Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs from right to left for gene C, as in the diagram. 5'- 3' Gene A Gene B Gene C 3' 5' Therefore, the template strand for gene A is the strand, the template strand for gene B is the strand, and the template strand for gene C is the strand,

Q: Which of the following features is common to both DNA replication and RNA transcription?     Both…

A: Nucleic acids, made up of nucleotide bases, as deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: It is known that the second amino acid in that protein is argınine, and if we zoom in and look in…

A: The coding strand is the sense strand of the DNA double helix that has the polarity of 5'--> 3'…

Q: In this diagram, the position marked "A" corresponds to the end of a new RNA molecule (shown in…

A: DNA The long chain of nucleoids that found in the nucleus of the cell and carry genetic information.

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: What is the sequence of the DNA template strand from which each of the following mRNA strands were…

A: To find the DNA template strand for each mRNA strand, recall that mRNA is produced from the DNA…

Q: Why do adult human cells (other than germ cells and stem cells) NOT express the enzyme telomerase?…

A: Telomerase expression is required for cell immortalization ( in cancer cells) and long term tumour…

Q: The MutH protein nicks the newly synthesized strand(Figure 16-23). How does it “know” which strand…

A: DNA mismatch repair (MMR) is a highly conserved biological pathway that plays a key role in…

Q: The DNA sequence below is used by the primase to synthesize a primer. What is the sequence of the…

A: The primer of this sequence will be complementary to it. The complementary bases are as follows: A…

Q: In the diagram shown below representing a replisome, the portion represented by the letter functions…

A: Ans. The method of DNA replication is a process in which double-strand DNA molecule copying in order…

Q: On the image showing the transcription of DNA to RNA, what does the letter F represent? Select the…

A:

Q: A new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first…

A: BASIC INFORMATION  RESTRICTION ENZYME  they are also known as molecular scissors it was in the year…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 :  Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: You obtained the sequence of the frog gene X you amplified in Question #16 through a process called…

A: A linear polymer of nucleotides is called as nucleic acid. DNA (Deoxyribonucleic acid) and RNA are…

Q: Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to…

A: Answer) The correct option is a) Eukaryotic mRNA.   In eukaryotes, The genes contain some non-coding…

Q: onsider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer.  Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Posttranscriptional modifications include adding a 5’ cap and a 3’ tail removing a 5’ cap and a 3’…

A: The process by which the information contained in a strand of DNA is transcribed into a new molecule…

Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…

A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…

Q: Why would telomerase be considered a reverse transcriptase?

A: Telomerase: It is also known as a terminal transferase. A telomere present on the end position of…

Q: Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′…

A: Transcription is the process in which the codes in DNA are transcribed to mRNA. This helps to…

Q: The -10 & -35 sequences specify __________ . Question 2 options: A) which strand is the template…

A: Introduction: The synthesis of the RNA molecule (mRNA) from the DNA is known as transcription.

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction :  One of the earliest steps in gene expression is transcription. The transfer of…

Q: An experiment is performed with Primase, using a specific DNA template. In this experiment, you…

A: Radiolabeled nucleotides are used for the detection of specific nucleic acid sequences. For…

Q: he of a hucleić áčid is the nitrogen bases. True

A: Nucleic acid is a biomolecule that was composed of a nitrogenous base, a pentose sugar, and a…

Q: r it 6- Complete the following: a) Two fragments of DNA can be joined by a b) Restriction enzymes…

A: Recombinant DNA technology is the process by which we can isolate our gene of interest and then…

Q: Transcribe an RNA from the following DNA Template sequence: 5’-CCA ATG GCA ATG ATT-3’

A: Gene expression begins with transcription. To create an RNA molecule, the DNA sequence of a gene…

Q: The RNA polymerase is only using one strand of DNA as a template, and only transcribes specific…

A: Introduction: DNA, also known as deoxyribonucleic acid, is the genetic material present in humans…

Q: Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can…

A: Transcription is the first of several steps of DNA based gene expression in which a particular…

Q: A major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages…

A: Eukaryotes are named so because they have a "true" nucleus. The genomic material in Eukaryotes is…

Q: How many times would telomerase have to bind to a different site in the telomere to make a segment…

A: During the time of DNA copying, one of the strands is synthesizing continuously at the replication…

Q: If a restriction enzyme cuts at this DNA sequence: TACGGAT, in general what is this sequence called?

A: DNA is a double-stranded molecule consisting of two strands of nucleotides. The bases in one strand…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.