In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give rise to an mRNA for protein A and the other DNA strand is transcribed to give rise to an mRNA for protein B.   a) Would there be any problem in expressing the two genes?   2. b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: Yeast have 8 similar tRNA genes with the anticodon 5’-GUA. A researcher mutates one of these genes…

A: Tranafer RNA helps in transporting amino acid as per the instructions given by messenger RNA during…

Q: In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand…

A: Introduction :  The genetic material in most organisms is DNA or Deoxyribonucleic acid. The…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: 4) where in the cell they occur, 2) one important protein (or protein containing complex) involved…

A: DNA Replication: Where : Nucleus Protein : Pre-replication complex (ORC1-6, Cdc6, Cdt 1 and MCM2-7…

Q: If a gene sequence is more tightly coiled around histones, then which of the following is the most…

A: When DNA or gene sequence is strongly attached to histones, however, transcription factors and RNA…

Q: 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner…

A: Proteins are an important organic compound. Some proteins stimulate the expression of a gene bind to…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: Many of the gene products involved in DNA synthesis were initially defined by studying mutant E.…

A: During DNA replication another copy of DNA is synthesized on DNA template strand using Polymerase…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: Insulin is a peptide hormone encoded by the INS gene, which is on chromosome 11. Insulin is produced…

A: The hormone insulin is required by the body to reduce the level of blood glucose. The pancreatic…

Q: After sequencing a segment of DNA you identify the following sequence: 5…

A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA.  DNA…

Q: Which of the following statements concerning the sequence of events involved in the initiation of…

A: Transcription is a process in which RNA transcript is formed from the DNA with the help of RNA…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: When Griffith incubated heat-killed virulent S strain bacteria with live avirulent R strains, he…

A: Griffith conducted a series of experiments and discovered the Transformation principle. S strain…

Q: onsider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer.  Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: 2. In the cytoplasm of the cell below, four tRNA molecules are carrying amino acids. a) What amino…

A: Translation is a 2 step process where nucleotide sequence transcribed from DNA present inside…

Q: The following DNA sequence corresponds to the complete coding sequence of a gene that codes for a…

A: mRNA codons are used to determine sequence in the original DNA and anticodons of tRNA.  tRNA…

Q: It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5…

A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…

Q: The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition…

A: E.coli is a type of bacteria that normally lives in the intestine. It is also found in the gut of…

Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…

A: Mutation can be divided into several categories. The types of mutation include missense mutation,…

Q: 14) Why are telomeres so important in eukaryotic organisms: A) Without telomeres, important DNA…

A: Telomeres are the section of a chromosome that is found at the end and does not contain any genetic…

Q: A certain membrane protein is found on the ER membrane with the N-terminus on the ER side of the…

A: This question is about the orientation of a particular membrane protein within the endoplasmic…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.