Imagine a disease that involves reduced expression of receptor X. There is no concentration of full agonist that can restore receptor X signaling back to normal levels. Explain how an allosteric modulator may be used to help in this situation.
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Which of the following statements concerning SDS in SDS-PAGE is INCORRECT? a. SDS is a negatively…
A: SDS-PAGE is an electrophoresis technique used to separate protein molecules. Protein molecules can…
Q: 1.) How do enzymes affect the proteins that we ate? 2.) How can co-enzymes affect enzyme activity?
A: Enzymes are bio catalysts that work to catalyse a biochemical reaction by decreasing its activation…
Q: 15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following…
A: Post translational modification are the modifications done in the protein by covalently attaching…
Q: For the structure shown on the figure - qualitatively draw Ramachandran plot. Assume a mixture of…
A: Ramachandran plot is plot used to visualize energetically allowed regions for the peptide backbone…
Q: Lipogenesis, or fatty acid synthesis, occurs in several cycles. A diagram of the reactions of the…
A: De novo synthesis of fatty acids takes place in the cytosol of all eukaryotes. Fatty acids are…
Q: Why can plant material be substituted? Plants contain high amounts of saturated fats. Certain plants…
A: Introduction : Linoleate - A linoleate is a salt or ester of linoleic acid(which is an organic…
Q: When a protein is folded in aqueous solution, some residues are driven inside to form a “hydrophobic…
A: Introduction Proteins are the most abundant macromolecule present in our body. Proteins performs…
Q: 1. What happens to the pyruvate made during glycolysis under anaerobic conditions? Is this a redox…
A: Glycolysis is the breakdown of one molecule of glucose (6C) into two molecules of pyruvate (2 x 3C)…
Q: Phosphatidic acid phosphatase (PAP), also called lipin, converts phosphatidate to diacylglycerol…
A: Phosphatidic acid phosphatase (PAP) or lipin converts phosphatidate to diacylglycerol (DAG), while…
Q: The condensation reaction catalyzed by ß-ketoacyl-ACP synthase synthesizes a four-carbon unit by…
A: Malonyl CoA is formed from carboxylation of Acetyl CoA through an ATP consuming process by biotin…
Q: The alkaline hydrolysis of pAUGCAGC oligonucleotide produces: O A. Uridine 2'-monophosphate, uridine…
A: Alkaline hydrolysis is a process by which RNA is degraded dur to attack of -OH ions of alkali. The…
Q: 1. Inulin is a polysaccharide composed of entirely fructose units. Which test should be used to best…
A: Introduction : Inulin - Inulin is a type of naturally occuring polysaccharide which is produced by…
Q: Question - is if the cells in our bodies were to convert the required energy into our food substance…
A: Energy must be supplied continuously for living things to exist. This energy is employed in part to…
Q: In glycatysis, conversion of a molecule, of glucose, into 2 Molecules of Pyryvate, results in a net…
A: Glycolysis is the process of conversion of one molecule of glucose to two molecules of pyruvate. A…
Q: What is the purpose of using a strong acid in the Seliwanoff’s test
A: Carbohydrates are polyhydroxy aldehydes or ketones or biomolecules that yield polyhydroxy aldehydes…
Q: 1. State if true or false a. GLUT5 transporter carries fructose from the intestinal lumen into the…
A: GLUT5 Transporter : GLUT5 is a fructose transporter found & expressed on the apical border of…
Q: Is ATP the only energy that the cell uses/or can use? Justify your answer
A: Introduction Cellular respiration is a process by which cell produces energy rich ATP molecule.…
Q: 1. Identify the encircled functional group (hydroxyl, carbonyl, amino, carboxyl). a) H3C. H3C S N NH…
A: There are four major classes of biological macromolecules called Nucleic Acids, Proteins,…
Q: In the given segment showing parallel strands, there are a total of In a parallel 3 sheet, hydrogen…
A: Beta sheets are secondary structures of proteins. They can be formed by a single peptide chain or…
Q: Fill in the blanks In the given reaction below, the amino acid HỌC NHỚ Coo NH4+ 2 0₂ H₂O₂ HC=0 coo…
A: Amino acids are converted to keto acids inorder to fuel the central process of the cell like…
Q: Propose a pathway for the following compound to enter gluconeogenesis / glycolysis. In your pathway,…
A: Glycolysis is a collection of 10 enzymatically catalysed reactions that sequentially oxidise a…
Q: 4) For the structure shown on the figure - qualitatively draw Ramachandran plot. Assume a mixture of…
A: Ramachandran plot is a 2-dimensional plot describing the allowed rotation in a protein. A protein…
Q: What is the free energy for transport of glucose from outside the cell to inside the cell 37°C when…
A: When an ion/molecule/solute moves up or down a concentration gradient, there is a change in free…
Q: Your supervisor asks to make 350 mL of a 0.75% (w/v) starch solution using a 5% (w/v) stock…
A: Given Values: Concentration of the starch stock solution = 5 % The volume of the final starch…
Q: 12. The graph shows values of arterial plasma bicarbonate concentration and pH for different persons…
A: Metabolic alkalosis is caused by acid base imbalance in the blood. It is characterised by increase…
Q: Triacylglycerols Store Energy Q4.3 - Describe the three sources of triacylglycerols in humans and…
A: Introduction: Triacylglycerols are also known as neutral fats or triacylglycerides, which are esters…
Q: Bacteriophage T7 encodes its own DNA polymerase, gp5, which has both polymerase activity and…
A: In the given graphs, the polymerase activity and exonuclease activity of DNA polymerase, gp5 is…
Q: What is something that allosteric effectors that alter the rate of catabolic or anabolic pathways…
A: Enzymes are biological catalysts that alter the rate of biochemical reactions. Allosteric enzymes…
Q: Energy is stored long-term in the bonds of _____ and used short-term to perform work from a(n)…
A: A molecule is defined in chemistry as a grouping of distinct atoms. Water molecules (H2O) and carbon…
Q: Which of the following statement about the enzyme thermodynamics is TRUE? a. Enzymes increase…
A: Introduction Enzymes are known as bio-catalyst. All the metabolic reaction of our body is enzyme…
Q: 29. What is the action of the Na/K pump? A. It is bidirectional for both ions B. It actively…
A: Introduction Plasma membrane or cell membrane is a outermost membrane in animal cell. It protect the…
Q: 1. Glucagon is a hormone that involves in the regulation of carbohydrate homeostasis.…
A: Proteins are made up of amino acid residues linked via a peptide bond. A peptide bond between two…
Q: Even though HbA is a heterotetramer (not all the subunits are the same), the alpha- and beta-globin…
A: Haemoglobin is a carrier protein that carries oxygen to the cells . It is present in red blood cells…
Q: actate dehydrogenase is a tetramer of MW 134000 g/mole composed of subunits which are equal in size.…
A: Lactate dehydrogenase belongs to the family of oxidoreductases. It catalyzes the conversion of…
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: Amino acids are the building blocks of proteins . they have two functional groups amine group and…
Q: Draw the Biosynthesis of fatty acids from Acetyl CoA pathway and identify the different types of…
A: The biosynthesis of fatty acids from the acetyl-CoA occurs in the cytosol. It involves the addition…
Q: Explain how important is biochemistry to you as a nursing student, and how can it help you?
A: The study of the makeup and operation of biological molecules such nucleic acids, proteins, and…
Q: 1. Under what circumstances in the cell would the entire pentose phosphate pathway be carried out…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: Which of the following statements concerning enzymes is TRUE? a. Enzymes can increase the…
A: Enzymes are biological catalysts that enhance the rate of biochemical reactions. The enzymes are…
Q: Formation of a peptide bond is a. dehydration reaction b. reducing reaction c.…
A: Proteins are composed of twenty naturally occurring amino acid. The amino acids in a protein are…
Q: HN 1. 2. 3. 4. 5. NH CH₂ EB HẠN–ệ—C H 8 Choose A if the statement is CORRECT B if the statement is…
A:
Q: How important is biochemistry in making vaccines and curing diseases?
A: Vaccination is immunization. a nontoxic or nonvirulent preparation of antigenic material is…
Q: A protein has the amino acid sequence DSRLSKTMYSIEAPAKLDWEQNMAL How many peptide fragments would…
A: Given to us is a protein with the following sequence: DSRLSKTMYSIEAPAKLDWEQNMAL and three reagents…
Q: Discuss in detail about the structure of protein .
A: Proteins are one of the four major biomacromolecules. Proteins can be composed of one or more…
Q: 8. Which of the following members of the ETC does not pump any protons into the intermembrane space?…
A: Electron Transport Chain (ETC). This component of aerobic respiration and the only component of…
Q: 2. Aspirin can be absorbed into the blood through the cells lining the stomach and the small…
A: Aspirin is a drug that is used to reduce pain, antiinflammation, and fever. Aspirin is chemically…
Q: A dialysis tube that contains 10 mL of a 5% sucrose solution and that is permeable to water but not…
A: Osmosis is a process by which a water moves from higher water concentration to lower water…
Q: Draw the structure of the following DNA sequence (5’-AG-3’) hydrogen bonded through Watson-Crick…
A: Nucleotides are molecules that have a nitrogenous base (Adenine, Thymine, Guanine, Cytosine and…
Q: Among the given statements, which are characteristics of plant cells? Select the correct…
A: Plant cell has Cell wall as the outermost layer. Cell wall being the outermost layer surrounds the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- List three ways in which a signal is amplified in a Gprotein-coupled receptor signaling pathway.Continuous exposure of a G protein-coupled receptor to its ligand leads to a phenomenon known as desensitization. Describe several molecule mechanisms for receptor desensitizationAMPK and mTOR can both be considered intracellular signal integrators. Explain this definition.
- Hormone H regulates these effects via its receptors which are found at both the cell surface (csRH) and within the cell (içRH). The signalling pathways that become activated in the presence of hormone H are depicted and described below. hormone H. H H extracellular fluid inactive GTP inactive RAS Lyn cell-surface receptor for H (csR») icR GDP RAS-GTP hexose metabolism cell survival H icR G, phase (resting) Raf HK GSK-3P MEK M G2 icR - hexose kinase ERK promoter HRE CDK1 Cyclin A nucleus cyclin A Fos A promoter Created in BioRender.com bio Signalling via the cell surface receptor Hormone H mediates its cell cycle stimulatory and pro-survival effects by binding to and activating the cell surface hormone H receptor (csRH). The activated CSRH activates Lyn, which activates RAS and ultimately the Raf/MEK/ERK kinase cascade. Active ERK: o phosphorylates and inactivates GSK-3B. Inhibition of GSK-3ß promotes cell survival. inhibits p27, preventing it from inhibiting cell cycle progression.…Explain how FRET could be used to monitor the association of Gαs and adenylyl cyclase following activation of the epinephrine receptor.Three potential inhibitors for VEGF were discussed in the signal transduction simulation. Explain two possible steps that these drugs can be expected to interfere with VEGF signaling (Hint: think about the requirements for signaling to occur).
- Nerve-growth factor (NGF) binds to a protein tyrosine kinase receptor. The amount of diacylglycerol in the plasma membrane increases in cells expressing this receptor when treated with NGF. Propose a simple signaling pathway and identify the isoform of any participating enzymes. Would you expect the concentrations of any other common second messengers to increase on NGF treatment?You are studying a drug that affects a cAMP signalling pathway that is normally initiated when a signalling molecule binds to a G-protein coupled receptor. You determine that the drug prevents the hydrolysis of GTP bound to G-proteins in this pathway. Describe the impact, if any, that this drug would have on the G-protein coupled receptor (GPCR), assuming that the pathway has been activated by the presence of the signalling molecule (first messenger). Include an explanation for your response.A particular protein can bind to receptor tyrosine kinase molecules inhibiting their dimerization (stops them from being able to form dimers). Explain what effect you think this protein could have on the signal transduction pathways that use tyrosine kinase as a receptor if it were to be present in a cell.
- Continuous exposure of a Gαs protein coupled receptor to its ligand leads to a phenomenon known as desensitization. Describe several molecular mechanisms for receptor desensitization. How can a receptor be reset to its original sensitized state? What effect would a mutant receptor lacking serine or threonine phosphorylation sites have on a cell?In the B-acrenergic receptor signaling pathway where desensitization occurs, what protein acts as an effector protein? The activity of the effector protein directly affects the activity of which protein in this pathway? How would the presence of a GAP affect the desensitization process? stimulate it inhibit it have no effect What is the actual mechanism by which desensitization occurs? the receptor is ubiquitinated the hormone is phosphorylated the hormone is degraded the receptor is internalizedRTKs are receptors made of an extracellular ligand binding domain and an intracellular kinase domain (see image). Insulin binds to its RTK Insulin receptor, causing an increase in glucose absorption and storage in liver cells. EGF binds to its own RTK, EGFR and promotes cell growth through the Ras pathway. a) Explain why the same type of tyrosine kinase in two RTKs can lead to very different cellular responses. Give an example of potential cellular outputs for each of these two RTKs.