Answered: If a person os homozygous for the…

If a person os homozygous for the presence of an ALU repeat in the PV92 region you would expect the size of the DNA fragment to be compared to those whith no ALUrepeats

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 13P: Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA...

See similar textbooks

Related questions

Q: Below is a sample of a segment of DNA…(copy from left to right) 3’…

A: Mutation It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: Figure 2 represents part of a DNA molecule. -3' G T 5' T АTGC Ттс с АGT TACG AAGG TCA 3' стТ C ure 2

A: DNA is a nucleic acid, one of the four major groups of biological macromolecules. All nucleic acids…

Q: A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . .…

A: The mutation occurs when there is an error in the sequence of the DNA. It could be because of the…

Q: Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited…

A: The trinucleotide repeat expansion is also called triplet repeat expansion. It is a DNA mutation and…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam…

A: A bacterial protein termed restriction enzyme, also known as molecular scissors, cleaves DNA at…

Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…

A: A single stranded nucleic acid is formed by joining the nucleotide units together through…

Q: How many of each base is found in the complete double-stranded molecule?

A: The concept is based on Chargaff's rule. It is given by Erwin Chargaff to calculate the amount of A,…

Q: Some molecules found in foods are known to be capable ofdriving DNA methylation or DNA…

A: Epigenetics means external modifications to a gene’s DNA which outcomes in alterations in gene…

Q: 5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…

A: DNA is a double helical structure containing complementary base pairs. Complementary base pairs…

Q: Shown below are eight DNA sequences from different individuals QGive the nucleotide positions of all…

A: SNPs or single nucleotide polymorphisms are due to the substitution of a single nucleotide that…

Q: All are propertles of nucleosomes EXCEPT: / Almal is eienskappe van nukleosome, behalwe: A. all are…

A: Nucleosome They are fundamental repeating subunits of all eukaryotic chromatin (except when…

Q: Since it was deciphered four decades ago, somehave claimed that the genetic code must be a frozen…

A: The frozen accident may be regarded as the default code evolution hypothesis since the comparable…

Q: Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome…

A: a. Exome: It is the part of a genome that contains all the exons.b. de novo gene: These are the new…

Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…

A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…

Q: A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3…

A: Alternation of DNA sequence or any other charge in the chromosome shape or number is considered as a…

Q: Two particular contigs are suspected to be adjacent, possibly separated by repetitive DNA. In an…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: Match the flower structure with what it produces. Anther [ Choose ] [Choose ] Ovary Endosperm Pollen…

Q: Table I CAC GTA GACTGAGG ACTC CACGTA GACTGAGG ACAC Wild-type beta-globin gene fragment Sickle-cell…

A: Abrupt changes in the DNA sequence of nucleotides is called mutation. Even a single nucleotide…

Q: The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true

A: DNA is the genetic material in humans. It contains all the genetic information that is transferred…

Q: I'd examine chromosomal dna what characteristic would cause you to believe sequence contard…

A: Transposable elements are DNA sequences that can move around the genome, either within a single…

Q: The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA…

A: Genetic codes are used to translate the information encoded within the genetic material. A codon is…

Q: Under physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids…

A: DNA and RNA are the biomolecules that are responsible for carrying genetic information in all living…

Q: Bloom syndrome in regards to faulty DNA give detailed reponses provide exmaples

A: Genetic diseases are diseases that are caused by abnormalities in genes. Autosomal disorders are…

Q: Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde /…

A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…

Q: oDNA THE DOUBLE HELIX -- (modified from The Biology Corner - Worksheets and Lessons) hody in a cell.…

A: DNA stands for deoxyribonucleic acid.DNA made up of nucleotides.DNA consists of deoxyribose sugar…

Q: . The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be…

A: Transcription is the process of synthesizing RNA (ribonucleic acid) molecule by using a template DNA…

Q: Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such…

A: Alternative RNA splicing is a fundamental post-transcriptional regulatory process that results in a…

Q: 4. What is the nitrogen base pair of Adenine in transcription? * Cytosine O Uracil O guanine thymine…

A: Nucleic acid is biological macromolecules that is exhibited inside the nucleus is the cell. It…

Q: A certain section of the coding (sense) strand of some DNA looks like this: 5- ATGGGCCACTCATCTTAG-3'…

A: Mutations are changes in the nucleotide sequence of DNA. The mutations can therefore affect the…

Q: Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up…

A: A nuclear localization sequence is an amino acid sequence that aids in protein transport (import)…

Q: The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode…

A: The C-terminal residue in a peptide is one that has a free carboxyl group or does not acylate…

Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…

A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Question

If a person os homozygous for the presence of an ALU repeat in the PV92 region you would expect the size of the DNA fragment to be compared to those whith no ALUrepeats

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Fig 3.16 EcoRI SacI KpnI |ampR Aval Xmal Smal lacZ BamHI Xbal SalI Accl HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? 3 O 4 O1 2
The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true
Shown below are eight DNA sequences from different individuals QGive the nucleotide positions of all single-nucleotide polymorphisms (SNPs; nucleotide positions where individuals vary in which base is present) in these sequences. uals
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
. The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age of 70 withamyotrophic lateral sclerosis (ALS), a paralyzing neurodegenerative disease that is usually fatal at a muchyounger age. Recently, geneticists discovered that amajor cause of ALS is the unusual expansion of ahexanucleotide repeat (5′-GGGGCC-3′) that lieswithin a gene called C9ORF72, at a location outside ofthe gene’s open reading frame (ORF). A single expanded allele is sufficient to cause ALS, but the reasonthe disease allele is dominant remains unclear. Someexperimental results support the theory that the allelemakes a toxic RNA containing the expanded repeat. Ifthis theory is correct, in what ways is the mutant ALScausing allele similar to the mutant allele that causesHuntington disease? In what ways is it similar to themutant allele that causes fragile X syndrome?
A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility
Why are some transposons medically important?
What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon mutagenesis with (a) HNO2, (b) bromouracil, and (C) 2-aminopurine.
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).
b bartleby Portal a portal.bartleby.com Apps G Gmail O Youlube Maps Hi reddy venkatesh 5/ 20 25 % > >> 14min 24 secs If a person is homozygous for the presence of an ALU repeat in the PV92 region, you would expect the size of the DNA fragment to be compared to those with no ALU repeats. Larger Smaller same size Cannot be predicted Next by ProProfs Create a Ouiz 1531 OE d ENG 23-09-2021 31°C 1O P Type here to search