The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: Batten disease is also known as neuronal ceroid lipofuscinoses. Batten disease is an autosomal…

Q: Most laboratory strains of E. coli contain site-specific DNA methylases. The methylase encoded by…

A: Molecular cloning is the process of making identical copies of a DNA molecule, which can be a gene,…

Q: Match the features to the labeled parts (Some may be used mutliple times, and not all labeled names…

A: Answer. A -  N terminus- A polypeptide synthesis proceeds from N- terminus to C-terminus and…

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: In the Western blot shown here, proteins were isolated from redblood cells and muscle cells from two…

A: Thalassemia is a blood disorder passed down through families (inherited) in which the body makes an…

Q: 23. Design the forward, reverse, and internal primers to the gene below and mutate the…

A: Primers are stretches of nucleic acids (either DNA or RNA) that help in DNA replication. DNA…

Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…

A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…

Q: Researchers have successfully used gene therapy toameliorate some human genetic diseases by adding…

A: Gene therapy is a process in which normal copies of genes are introduced into cells, where they can…

Q: 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner…

A: Proteins are an important organic compound. Some proteins stimulate the expression of a gene bind to…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: The ds DNA strand between position 20-30 3'- GATACGCGATG- 5' The sequence of primer that will be…

Q: People with a commonly occurring, wild type allele of PTC with two adjacent thymines at a particular…

A: Part a.) :-ans.The presence of two adjacent thymines at a specific site in the PTC coding sequence…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…

A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…

Q: a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: How many of the mutations listed below would lead to excessive cell growth when the cell was either…

A: Excessive growth occurs when a cell continuously divides and when there is no cell cycle arrest. Myc…

Q: Based on the following wild type sequence, indicate if each of the mutations should be classified as…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: One problem that researchers sometimes encounterwhen editing genomes with CRISPR/Cas9 is that oneor…

A: The gene therapy or gene editing is an asset for humans, as many of the gene-related disorders can…

Q: In the absence of tryptophan and the trpD structural gene contains a frameshift insertion mutation,…

A:

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: silent mutation is a type of point mutation in DNA that doesn't show any observable effect on the…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: . a. What are all the transversions that can be made starting with the codon CGG?b. Which of these…

A: In molecular biology, a point mutation in DNA occurs when a single (two ring) purine (A or G) is…

Q: In addition to Tc1, the C. elegans genome contains otherfamilies of DNA transposons such as Tc2,…

A: Transposons are mobile DNA segments. They can replicate and insert copies at various chromosomal…

Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…

A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: When the sequence CpG occurs, the cytosine can be methylated. If a methylated cytosine is then…

A: Introduction CpG islands:- The CpG sites are a portion of DNA where a guanine nucleotide present…

Q: Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide…

A: Given : Ser-Gly-Lys-Glu-Gly-Lys-Lys 1 amino acid : 3 codons 7 amino acids : 7×3= 21 codons

Q: Identify the type of point mutation on the following strands (transition or transversion):  a. 5’…

A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…

Q: In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the…

A: CRISPR is a DNA sequence that found in prokaryotic organism's genome like bacteria , archaea.…

Q: Select all the possible mutation types for the following observed phenotype resulting from a…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.