If a DNA sequence , 3' TAC AAT GAA 5' , is the template for transcription, the resulting mRNA would be translated into which protein below?

Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: Assume 102 nucleotide pairs of DNA to be responsible for transcription of particular mRNA molecule.…

A: mRNA stands for messenger RNA a type of RNA (ribonucleic acid) molecule that plays a crucial role in…

Q: For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all…

A: A mutation is a known as a change to an organism's DNA sequence. A single nucleotide is altered by…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all…

A: According to the question, the sequence 5 has the mutation highlighted in orange. Also given a…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the…

A: Gene is a sequence of nucleotides that encode a particular protein. The transcription and…

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…

A: The ending of termination and the process involved in it are called transcription termination. The…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…

A: Given: DNA sequence

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: For translation, identify two things that happen during each step - initiation, elongation and…

A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…

Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: A sequence of nucleotides in a DNA strand—5′-ttAACggCttttttC-3′— was used as a template to…

A: A template strand is the strand of the DNA that is also called a non-coding strand. By complementary…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for…

A: The original mRNA sequence:5'-UUG ACC GAC-3'To determine the amino acid sequence, it is important to…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG.…

A: Given,Original Codon Sequence: AUGACCCGGCUACUGMutant Codon Sequence: AUGACCCGGUUACUGOriginal Protein…

Q: Derive the amino acid sequence that is coded by this mRNA sequence. Use three-letter amino acid…

A: Proteins are made up of amino acids and are necessary for the efficient operation of all living…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…

Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…

A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…

Q: F10 (PC) or ALT+FN+F10 (Mac). Paragraph Arial 14px

A: Central dogma is the process in which DNA is transcribed in to mRNA is called transcription and mRNA…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.