Answered: How many amino acids would there be in…

How many amino acids would there be in the protein produced from the following mRNA molecule ? AUGUCGUUUAGUCUGAAUCAAACCGGGCGUUAG 10 О11 O4

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Related questions

Q: Please state which letter is the correct answer. 1 letter (answer) only.

A: Inflammatory response It is occurred when tissue is injured by trauma, bacterias, toxins etc.

Q: abbreviations please answer al|

A: The solubility of proteins is affected by a number of intrinsic as well as extrinsic factors. The…

Q: -A wild-type strain. -A strain that contains a 15 base-pair deletion in the lac operon operator…

A: The widely used and closely related Escherichia coli "wild types" W3110 and MG1655, as well as…

Q: What item is not normally included in a sexual assault kit? Anal specimen Vaginal specimen urine…

A: Nursing is the profession of healthcare that delivers care to the patient in order to cure them and…

Q: What item is not normally included in a sexual assault kit?

A: Sexual assault: It is an act of violence in which one person tries to involve another person in a…

Q: Fill in the Punnett Square below. The first box is done for you. b b bb B

A: Punnet square is a square representation in which gametes from parent genotype are present on the…

Q: can you please label on the image i have provided

A: The nucleus is present within the cell and constitutes chromosomes. Connective tissue is responsible…

Q: info

A: A blood clot in a vein causes a condition known as venous thromboembolism (VTE). Deep vein…

Q: Does this test prove conclusively that either man is Frank’s father? Why or why not?

A: By comparing the band patterns with Frank we can say Barb is the father of Frank.

Q: please label answer quickly

A: We can say that A specific cell that carries signals and messages from and to the brain and various…

Q: Stephanie Byrd is a coder a Greensburg Medical Center. Her user ID is sbyrd. She recently got…

A: Medical coding is a process of converting clinical diagnosis, procedures, services, and equipment…

Q: The image shows the___________and the____________________.

A: The parathyroid glands are two pairs of small glands located at the posterior side of the thyroid…

Q: Match each statement with column B(can only be used once). Thank you.

A: Cancer cells undergo several changes in their cellular biochemistry. These changes are the basis of…

Q: Drag and drop the missing words from the list below to complete the following sentences. Please…

A: Note: As per authoring guidelines solving only three subparts. Repost remaining, please. Correct…

Q: OTC is an abbreviation for

A: OTC drugs are the medications which are sold directly to the clients.

Q: CASE STUDY GIVEN THIS SCENARIO: Mr. and Mrs. Reyes died in a tragic accident when they went to a…

A: The Punnett Square tells about the possible genotype and phenotype produced from a genetic cross.

Q: Post a short summary about the assigned video posted below…

A: The video discusses the hematopoiesis map. Hematopoiesis refers to the process of formation of new…

Q: Explain the additional health risks to a patient undergoing a CT scan as compared to an ordinary…

A: A CT (computed tomography) scan may more effectively capture bones and arteries all at once than an…

Q: (5 sentences pls, ans

A: First aid can be defined as the immediate medical assistance provided to the person to preserve the…

Q: d and it was wrong

A: The best way to test the hypothesis would be d. Test if male macaques who have had their faces…

Q: write the description of the picture

A: The bones of the upper and lower limbs and the bones of the girdles together make the appendicular…

Q: Can you help me identify the fractions pls. ASAP!!! Please and thank you!!

A: A dihybrid cross is a experiment between the two individuals that belongs to same hybrids for two…

Question

**NOTE: Choose the correct answer

How many amino acids would there be in the protein produced from the following mRNA molecule?
AUGUCGUUUAGUCUGAAUCAAACCGGGCGUUAG
O 3
10
11
4

Cytokinesis occurs
mitosis.
O before
O during
O after

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Stop codons

VIEW

Cytokinesis

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart.
Given the following mRNA sequence, write the peptide sequence that will result from protein translation. Please indicate the correct directionality.
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
How many open reading frames are present in the following mRNA sequence? You may find the codon table helpful. 5' AAUGGGAAUUCCCGAUGAAUAUAATCGTCCTGCATUGAUGGUCCAUGCAAGU 3'OH
If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTY
Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
Identify the type of mutation present in the CDS and discuss the implications on the protein.
For the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA First position U C A UUU UUC UUA UUG CUU CUC CUA CUG U >Phe GUU GUC GUA GUG >Leu >Leu AUU ACU AUC lle ACC AUA ACA AUG Met/start ACG >Val UCU UCC UCA UCG ©2019 Pearson Education, Inc. CCU CCC CCA CCG GCU GCC GCA GCG Second position A >Ser >Pro Thr >Ala UAU UGU U UAC UGC C UAA Stop UGA Stop A UAG Stop UGG Trp G CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr >His >Gin >Asn >Lys >Asp >Glu CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG >Cys Arg >Ser >Arg >Gly DOAG SCAG U с А UCA с А G Third position Correct answer not given Met-Val-Tyr-Pro Met-His-Phe-Ala-Arg Pro-Val-Met-Leu-His Met-Pro-Val-Glu
Find 5’ UTR and 3’UTR of Mrna 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’