Highlight or underline or bold both the start and stop codons

Q: I have a presentation on the discovery of the genetic code, but I don't know how to organize my…

A: Presentation should start with a brief introduction about the genetic code. It should cover the most…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: Complete the following chart. Region Length Multiples of 3?

A: RNA is abbreviated as ribonucleic acid and it is composed of a ribose sugar, which is attached with…

Q: Why is specific base pairing essential to the processes of transcription and translation? - How many…

A: The DNA is composed of sugar and phosphate that serves as the backbone, and at each sugar, a…

Q: How many codons can mutate to become nonsense codons through a single base mutation of the first…

A: The association of 5mC with alternative splicing also challenges the general repressive role…

Q: Define . Nonsense codon  as they apply to the genetic code

A: Codons are the triplet of nucleotides present in DNA (deoxyribonucleic acid) or RNA (ribonucleic…

Q: Aspartate and phenyalanine become apartate and isoleucine

A:

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: To which of the following tRNA structures is the amino acid attached with during aminoacylation?…

A: The production of polypeptide chain from the mRNA (contain genetic codons) is known as translation…

Q: a b Select one or more answers and submit. For keyboard navigation... SHOW MORE ✓ Transcription…

A: Introduction :- The process of transcribing a piece of DNA into RNA is known as transcription.…

Q: The variation in the length of tandem repeat of microsatellite DNA has serious translational affects…

A: Microsatellite is a repetitive DNA sequence, in microsatellite some DNA motifs are repeated for so…

Q: Same sense mutation is usually non-destructive due to the degeneracy of codons.    Group of answer…

A: Same sense Mutations are the point mutations that lead to form a different codon but it is…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Separate the following strand into codons: UGAAUUAUCGCG Your answer

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: Codons are bases long. Select an answer and submit. For keyboard navigation, use the up/down arrow…

A: DNA is a polymer of nucleotides and each  nucleiotide is made up of deoxyribose sugar which is the…

Q: Define Sense codon  as they apply to the genetic code

A: Sense codons are those codons which specify amino acids at the time of protein synthesis…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: Cxikeria DNA Transcription Translation Location

A: The central dogma, central to the cellular process functions in transcription by conversion of DNA…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: Place sequences a, b and c into the correct order based on start and stop codons. Sequence A…

A: Introduction  Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: Once you have cut your circular DNA it becomes linear and you need to insert/glue the functional…

A: Recombinant DNA technology It is a technique that alters the phenotype of an entity(host) when a…

Q: What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and…

A: Please follow step 2 for detailed explanation.

Q: You create a premature stop codon as a result of an induced mutation in the lab. What type of…

A: Premature termination codons (PTCs) are the result of one-nucleotide changes that transform a…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: True or False: there are three different start codons in the genetic code

A: The hereditary code is degenerate for example beyond what one codon can code for a solitary amino…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…

A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…

Q: Transcribe the following DNA molecule into mRNA.  Make sure to find the start codon to begin your…

A: A start codon initiates the transcription while stop codon terminates the transcription process.

Q: These are written as either accurate or contain errors. Rewrite each one with an error as an…

A: The mutations in the genome are the source of the genetic variations in a population. The changes in…

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…

A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…

Q: Frameshift mutation _____________________ Select one: can result in a completely new codon sequence…

A: These mutations include insertions or deletions in between the nucleotide sequence of the genome,…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…

Q: DNA sequence, while a substitution will affect only the one codon (set of: DNA. For example:…

A: Mutation is defined as the change in the DNA sequence. These are sudden changes caused by various…

Q: What do you understand by the degeneracy of codon? Give example

A: The DNA contains the information needed for the functioning of all living things in the form of…

Q: Select the correct terms: The genetic code demonstrates (ambiguity / redundancy) because some amino…

A: Genetic code is a set of rules that are followed in translation of genetic material in the form of…

Q: A standard codon table such as the one that we looked at in class gives the following information:

A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…

Q: State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3'…

A: Introduction :- A codon is a sequence of three nucleotides (A, C, G, or T) that encodes for a…

Q: he anticodon for the codon GCA is:

A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…

Q: Define Reading frame as they apply to the genetic code

A: The central dogma of life is- DNA ---> mRNA ---> Protein The process of formation of mRNA from…

Q: Use the first picture and codon table to answer the following questions.

A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.