Higashi et al. (1986) found that three critical mutations were found in one of the two genes coding for 21-hydroxylase to render the gene nonfunctional. The following is a partial DNA sequence from one of the 21-hydroxylase genes where one of the three most common mutations occurs. For the following

Q: Some animals like C. elegans, do not have 5-methylcytosine, but do have methylated adenine. It is…

A: DNA methylation is known as epigenetic mechanism. It occurs when a methyl group is added to DNA and…

Q: Are genes A, D, and E all under the control of operator O? Explain your reasoning

A: Introduction: In E.coli, the structural genes A,D, and E codes for enzymes A,D, and E respectively…

Q: If you could microinject cytochrome c into the cytosol of wild-type mammalian cell and another set…

A: Cytochrome c was microinjected into the cytosol of wild-type mammalian cell .Another type of cells…

Q: Mutation of codon 34 (CAC to GAC) and 85 (CGT to CAT) of the insulin gene causes hyperinsulinemia…

A: In codon 34, CAC codes for the amino acid Histidine. CAC is replaced by GAC which codes for Aspartic…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: RNA splicing is the process of removal of non coding sequences called as introns and joining of…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…

Q: A gene encodes a protein with the following amino acid sequence: Met-Lys-Ser-Pro-Ala-Thr-Pro A…

A: Given gene sequence: Met-Lys-Ser-Pro-Ala-Thr-Pro the gene then produces a protein with the amino…

Q: Compare and contrast Prokaryotic and Eukaryotic transcription. For full credit, you must describe…

A: Transcription is the process in which RNA is synthesized from the DNA. It occurs in three stages-…

Q: What type of mutation is C c?

A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…

Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…

A: Gene expression is a process by which genetic information from a gene is used for the production of…

Q: Which of the following best explains how the expression of a eukaryotic gene encoding a protein will…

A: The central dogma is common throughout the life forms on earth: i.e. DNA to RNA to Protein. Having…

Q: Suppose that the diagram below represents the genomic organization of an enzyme involved in eye…

A: Transcription is the process by which  RNA transcript is formed from DNA. Various type of RNA are…

Q: Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also…

A: Hypothesis is basically a proposed explanation for any naturally occurring phenomenon in the…

Q: Which of the following mutations in a gene will most likely have the greatest impact on the…

A: Mutation is any change in structures or functional aspects of gene (genome ) which may occur due to…

Q: suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: The SARS-CoV-2 genome has a cap at its 5'-end that is the same as the one seen on most human mRNA…

A:

Q: The relationship between the gene and the synthesis of a specific protein: Describe the steps in the…

A: Maltase is an enzyme that breaks down maltose in to its monomers.

Q: Geneticists often use ethylmethane sulfonate (EMS) to induce mutations in Drosophila. Why is EMS a…

A: Ethylmethane sulfonate (EMS) : It is a mutagenic, teratogenic and possibly carcinogenic organic…

Q: A plant geneticist was examining the inversion mutation XI 501 in barley where a segment of DNA is…

A: Any alteration occurring in the DNA sequence of an organism is known as mutation.

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the…

A: Genetic codes are stored in the form of trinucleotide sequences (codons) in the mRNA.The mRNA gets…

Q: Let’s suppose that a vertebrate organism carries a mutation that causes some cells that normally…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Consider a single base insertion mutation between the 3rd and 4th codons in a natural gene that…

A: Amino acid  The building blocks of proteins. The protein is a polymer made up of chain of amino…

Q: Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In…

A: The genes are the functional part of the DNA that are responsible for the production of RNA by the…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

A:

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Alternative splicing is a process that enables a messenger RNA to direct the synthesis of different…

Q: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your…

A: Rho utilization site , also known by the acronym rut is a sequence of RNA in bacteria upstream of…

Q: . Genes A, B, and C encode enzymes A, B, and C, which are part of this biosynthetic pathway:…

A: If the gene A,B,C are presemt in the eukaryotes and bacteria and since 1 is prokaryotic and another…

Q: You are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the…

A: Definition Mutations are changes in DNA sequence. it can result from DNA copying mistakes , made…

Q: Let us suppose that a vertebrate organism carries a mutation that causes some cells that normally…

A: The addition of methyl groups into DNA molecule is called DNA methylation. The activity of the DNA…

Q: . Seven E. coli mutants were isolated. The activity ofthe enzyme β-galactosidase produced by cells…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: In eukaryotes, which of the following statements is correct with regard to introns and exons?…

A: Eukaryotic DNA carries the nonprotein coding sequences.

Q: You have created three different mutations in the histoneH1 protein (HISmut1, HISmut2, HISmut3), and…

A: Histone 1 is a type of protein involved in chromatin remodelling. It is a part of histone protein…

Q: Do you think that the alternate splicing of exons may enable a structural gene to code for several…

A: Alternative splicing is a basic regulatory process of gene expression. This process is very…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: As we described in class, in the early 1960's Francis Crick and colleagues set out to determine how…

A: Introduction  Genetic code   The sequence of bases that encodes a functional protein molecule is…

Q: In order to manufacture insulin for patients with diabetes, scientists create recombinant DNA by…

A: Recombinant DNA technology is the method which scientists used to insert human gene into bacterial…

Q: A SNP that results in loss of all catalytic activity of a drug-metabolizing enzyme is most likely to…

A: snip is genetic variation which may leads to replace cytosine with thymine at the same places along…

Q: In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule?…

A: Transcription is the process by which messenger rna is made from DNA.  This process takes place…

Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…

A: The nucleotides in RNA (ribonucleic acid) or DNA (deoxyribonucleic acid) sequence are read as…

Q: Using a computer algorithm that searches for sequence similarities in other organisms, you discover…

A: Hexose Kinase gene helps in sugar signaling and carbohydrate metabolism. Among the three DNA hybrids…

Q: Describe how transcription would be affected in the Galactose metabolizing pathway in Yeast in the…

A: Answer: Introduction: Galactose consumption in S. cerevisiae carried out by the Leloir pathway, in…

Q: ransfer RNA in eukaryotic cells is synthesized by which of the following enzymes (sensitive to high…

A: α-amanitin is a cyclic octapeptide that contains several modified amino acids.

Q: In studying the mechanism of a particular enzyme, for which the cloned gene is available, you wish…

A: Site-directed mutagenesis is the molecular biology technique that alters the sequence of the target…

Q: What kinds of effects can occur on cellular metabolism when we introduce genetic modifications into…

A: Metabolism is driven by specific enzymetic products of gene expression , and gene expression…

Q: Many aspects of gene function can be nicely explained with the one-gene-one-enzyme hypothesis, which…

A: It states that "a gene controls the synthesis of one enzyme". It was carried out using Neurospora…

Q: What do you predict that you would find when comparing the mRNA and protein products of the mutated…

A: Spinal muscular atrophy(SMA) SMA is characterized by the loss of motor neurons, nerve cells in the…

Q: Which of the following is likely associated with the mRNA processing step of alternative splicing?

A: A process that helps a single gene to code for many proteins is known as alternate splicing. It is…

Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…

A: Introduction The central dogma of molecular biology describes the flow of genetic information from…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.